Rat DAB1(Disabled Homolog 1) ELISA Kit

Rat DAB1(Disabled Homolog 1) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Rat Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Ra-48Tests 48 Tests
EUR 557

Rat Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Ra-96Tests 96 Tests
EUR 775

Human Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Hu-48T 48T
EUR 517
  • Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Hu-96T 96T
EUR 673
  • Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Mu-48T 48T
EUR 527
  • Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Mu-96T 96T
EUR 688
  • Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit

RDR-DAB1-Hu-48Tests 48 Tests
EUR 544

Human Disabled Homolog 1 (DAB1) ELISA Kit

RDR-DAB1-Hu-96Tests 96 Tests
EUR 756

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

RDR-DAB1-Mu-48Tests 48 Tests
EUR 557

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

RDR-DAB1-Mu-96Tests 96 Tests
EUR 774

Human Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Hu-48Tests 48 Tests
EUR 521

Human Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Hu-96Tests 96 Tests
EUR 723

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Mu-48Tests 48 Tests
EUR 533

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Mu-96Tests 96 Tests
EUR 740

Rat Disabled Homolog 1 (DAB1) ELISA Kit

20-abx155443
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Disabled Homolog 1(DAB1)ELISA Kit

QY-E10335 96T
EUR 361

Rat Disabled Homolog 1 (DAB1) ELISA Kit

SEG171Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids.

Rat Disabled Homolog 1 (DAB1) ELISA Kit

SEG171Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids.

Rat Disabled Homolog 1 (DAB1) ELISA Kit

SEG171Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids.

Rat Disabled Homolog 1 (DAB1) ELISA Kit

SEG171Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids.

Rat Disabled Homolog 1 (DAB1) ELISA Kit

4-SEG171Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Disabled Homolog 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Disabled Homolog 1 (DAB1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Disabled Homolog 1 (DAB1) Protein

20-abx168517
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Disabled Homolog 1 (DAB1) Antibody

20-abx130098
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Disabled Homolog 1 (DAB1) Antibody

20-abx172135
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Disabled Homolog 1 (DAB1) Antibody

abx331920-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Disabled Homolog 1 (DAB1) Antibody

20-abx328081
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Disabled Homolog 1 (DAB1)

4-RPG171Ra01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8CJH2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Disabled Homolog 1 expressed in: E.coli

Rat Disabled Homolog 1 (DAB1) CLIA Kit

20-abx495119
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit

abx572870-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Rat DAB1 (Disabled Homolog 1)

ELK6761 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Disabled Homolog 1 (DAB1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Disabled
  • Show more
Description: A sandwich ELISA kit for detection of Disabled Homolog 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Disabled Homolog 1 (DAB1)ELISA Kit

201-12-2657 96 tests
EUR 440
  • This Disabled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Mouse Dab1/ Disabled homolog 1 ELISA Kit

E0377Mo 1 Kit
EUR 632

Human DAB1/ Disabled homolog 1 ELISA Kit

E0654Hu 1 Kit
EUR 605

Human DAB1(Disabled homolog 1) ELISA Kit

EH1419 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: O75553
  • Alias: DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Disabled homolog 1, DAB1 ELISA KIT

ELI-04118h 96 Tests
EUR 824

Mouse Disabled homolog 1, Dab1 ELISA KIT

ELI-04119m 96 Tests
EUR 865

Mouse Dab1(Disabled homolog 1) ELISA Kit

EM0551 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: P97318
  • Alias: Dab1/DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml

Human Disabled Homolog 1(DAB1)ELISA Kit

QY-E04976 96T
EUR 361

Mouse Disabled Homolog 1(DAB1)ELISA Kit

QY-E20475 96T
EUR 361

Dab1 ELISA Kit| Rat Disabled homolog 1 ELISA Kit

EF018591 96 Tests
EUR 689

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat)

4-PAG171Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1)

Disabled Homolog 1 (Drosophila) (DAB1) Antibody

20-abx009346
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Disabled Homolog 1 (Drosophila) (DAB1) Antibody

20-abx125745
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit

abx254902-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit

abx250694-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Dab1 ELISA Kit| Mouse Disabled homolog 1 ELISA Kit

EF013178 96 Tests
EUR 689

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), APC

4-PAG171Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with APC.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), Biotinylated

4-PAG171Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with Biotin.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), Cy3

4-PAG171Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with Cy3.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), FITC

4-PAG171Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with FITC.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), HRP

4-PAG171Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with HRP.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), PE

4-PAG171Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with PE.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), APC-Cy7

4-PAG171Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with APC-Cy7.

Disabled Homolog 1 Phospho-Tyr232 (DAB1 pY232) Antibody

20-abx328082
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Mouse Disabled homolog 1

EK3038 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Disabled homolog 1

EK3039 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Recombinant human Disabled homolog 1

P1350 100ug Ask for price
  • Uniprot ID: O75553
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Disabled homolog 1

Dab1/ Rat Dab1 ELISA Kit

ELI-04117r 96 Tests
EUR 886

Human DAB2/ Disabled homolog 2 ELISA Kit

E0655Hu 1 Kit
EUR 571

ELISA kit for Human Disabled homolog 2

EK4306 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human DAB2(Disabled homolog 2) ELISA Kit

EH2115 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P98082
  • Alias: Disabled-2/DOC2/Differentially-expressed protein 2/disabled(Drosophila) homolog 2(mitogen-responsive phosphoprotein)/disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)/DOC-2DOC2
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Disabled homolog 2, Dab2 ELISA KIT

ELI-06819m 96 Tests
EUR 865

Human Disabled homolog 2, DAB2 ELISA KIT

ELI-06821h 96 Tests
EUR 824

Disabled Homolog 2 (DOC2) Antibody

abx224346-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Human Disabled homolog 2- interacting protein, DAB2IP ELISA KIT

ELI-07864h 96 Tests
EUR 824

Mouse Disabled homolog 2- interacting protein, Dab2ip ELISA KIT

ELI-32113m 96 Tests
EUR 865

Rat Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) ELISA Kit

abx519481-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

DAB1 ELISA Kit (Rat) (OKCD02379)

OKCD02379 96 Wells
EUR 896
Description: Description of target: Adapter molecule functioning in neural development. May regulate SIAH1 activity. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.107 ng/mL

Recombinant human Disabled homolog 2-interacting protein

P1522 100ug Ask for price
  • Uniprot ID: Q5VWQ8
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Disabled homolog 2-interacting protein

Anti-Dab1 (Ab-232) Antibody

A03459-1 100ul
EUR 397
Description: Rabbit Polyclonal Dab1 (Ab-232) Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Human DAB1 ELISA Kit

ELA-E12413h 96 Tests
EUR 824

DAB1 ELISA KIT|Human

EF004751 96 Tests
EUR 689

Dab1 Cell ELISA Kit

abx595170-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) ELISA Kit

abx251448-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) ELISA Kit

abx519480-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

20-abx002772
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

20-abx112096
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (Dab2) Antibody

abx031161-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (Dab2) Antibody

abx031161-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

abx034186-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

abx034186-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

20-abx242091
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

20-abx242092
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

abx232228-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Rat DAB1 shRNA Plasmid

20-abx988097
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Dab1 Recombinant Protein (Rat)

RP197279 100 ug Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Rat Notch Homolog 1 ELISA kit

E02N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Notch Homolog 1 ELISA kit

E02N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Notch Homolog 1 ELISA kit

E02N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dab1 Colorimetric Cell-Based ELISA Kit

EKC1162 100ul
EUR 572

Dab1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6710302 1.0 ug DNA
EUR 154

Dab1 antibody

20R-2409 50 ug
EUR 281
Description: Rabbit polyclonal Dab1 antibody

DAB1 Antibody

1-CSB-PA002060
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DAB1. Recognizes DAB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

DAB1 antibody

70R-4084 50 ug
EUR 467
Description: Rabbit polyclonal DAB1 antibody

DAB1 antibody

70R-49648 100 ul
EUR 244
Description: Purified Polyclonal DAB1 antibody

Dab1 antibody

70R-34079 100 ug
EUR 327
Description: Rabbit polyclonal Dab1 antibody

Dab1 antibody

70R-34081 100 ug
EUR 327
Description: Rabbit polyclonal Dab1 antibody

Dab1 Antibody

AF6029 200ul
EUR 304
Description: Dab1 Antibody detects endogenous levels of total Dab1.

DAB1 siRNA

20-abx901401
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DAB1 siRNA

20-abx913525
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DAB1 siRNA

20-abx913526
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Dab1 Antibody

AF7654 200ul
EUR 376
Description: Dab1 Antibody detects endogenous levels of Dab1.

Dab1 Antibody

ABF6029 100 ug
EUR 438

anti-DAB1

YF-PA11270 50 ul
EUR 363
Description: Mouse polyclonal to DAB1

anti-DAB1

YF-PA11271 50 ug
EUR 363
Description: Mouse polyclonal to DAB1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Dab1 ORF Vector (Rat) (pORF)

ORF065761 1.0 ug DNA
EUR 506

Rat TIMP-1 AssayMax ELISA Kit

ERT2538-1 96 Well Plate
EUR 477

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody

A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Rat Slit Homolog 1 (Slit1) ELISA Kit

DLR-Slit1-Ra-48T 48T
EUR 549
  • Should the Rat Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit

DLR-Slit1-Ra-96T 96T
EUR 718
  • Should the Rat Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Protein pellino homolog 1 ELISA kit

E02P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein pellino homolog 1 ELISA kit

E02P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein pellino homolog 1 ELISA kit

E02P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crumbs homolog 1(CRB1) ELISA kit

E02C2038-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crumbs homolog 1(CRB1) ELISA kit

E02C2038-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crumbs homolog 1(CRB1) ELISA kit

E02C2038-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Achaete scute homolog 1 ELISA kit

E02A0079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Achaete scute homolog 1 ELISA kit

E02A0079-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Achaete scute homolog 1 ELISA kit

E02A0079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Slit Homolog 1 (Slit1) ELISA Kit

20-abx156095
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Dickkopf 1 Homolog (DKK1) ELISA Kit

20-abx155444
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Dickkopf 1 Homolog (DKK1) ELISA Kit

abx256873-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Robo1/ Roundabout homolog 1 ELISA Kit

E0848Ra 1 Kit
EUR 646

Rat Roundabout homolog 1, Robo1 ELISA KIT

ELI-42660r 96 Tests
EUR 886

Rat Nitrilase homolog 1 (NIT1) ELISA Kit

abx391718-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Roundabout homolog 1 (ROBO1) ELISA Kit

abx556264-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Frizzled Homolog 1 (FZD1) ELISA Kit

abx515257-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Frizzled Homolog 1(FZD1)ELISA Kit

GA-E0957RT-48T 48T
EUR 317

Rat Frizzled Homolog 1(FZD1)ELISA Kit

GA-E0957RT-96T 96T
EUR 496

Rat Frizzled Homolog 1(FZD1)ELISA Kit

QY-E10695 96T
EUR 361

Rat Slit Homolog 1 (Slit1) ELISA Kit

RD-Slit1-Ra-48Tests 48 Tests
EUR 557

Rat Slit Homolog 1 (Slit1) ELISA Kit

RD-Slit1-Ra-96Tests 96 Tests
EUR 775

Rat Slit Homolog 1 (Slit1) ELISA Kit

SED354Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit

SED354Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit

SED354Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit

SED354Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit

4-SED354Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Slit Homolog 1 elisa. Alternative names of the recognized antigen: MEGF4
  • SLIL1
  • SLIT3
  • Multiple epidermal growth factor-like domains protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Slit Homolog 1 (Slit1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Slit Homolog 1 (Slit1) ELISA Kit

RDR-Slit1-Ra-48Tests 48 Tests
EUR 583

Rat Slit Homolog 1 (Slit1) ELISA Kit

RDR-Slit1-Ra-96Tests 96 Tests
EUR 811

Dab1 Colorimetric Cell-Based ELISA Kit (OKAG00660)

OKAG00660 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

DAB1 ELISA Kit (Human) : 96 Wells (OKEH02231)

OKEH02231 96 Wells
EUR 662
Description: Description of target: The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.093 ng/mL

DAB1 ELISA Kit (Mouse) : 96 Wells (OKEH02232)

OKEH02232 96 Wells
EUR 779
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39 ng/mL

Nit1 ELISA Kit| Rat Nitrilase homolog 1 ELISA Kit

EF019078 96 Tests
EUR 689

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

DAB1 Polyclonal Antibody

27390-100ul 100ul
EUR 252

DAB1 Polyclonal Antibody

27390-50ul 50ul
EUR 187

DAB1 Rabbit pAb

A10349-100ul 100 ul
EUR 308

DAB1 Rabbit pAb

A10349-200ul 200 ul
EUR 459

DAB1 Rabbit pAb

A10349-20ul 20 ul
EUR 183

DAB1 Rabbit pAb

A10349-50ul 50 ul
EUR 223

DAB1 Blocking Peptide

33R-7396 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DAB1 antibody, catalog no. 70R-4084

Dab1 antibody (Tyr232)

70R-34080 100 ug
EUR 327
Description: Rabbit polyclonal Dab1 antibody (Tyr232)

Dab1 (pY232) Antibody

abx010623-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

DAB1 Blocking Peptide

20-abx062523
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Dab1 Blocking Peptide

AF6029-BP 1mg
EUR 195

Dab1 Blocking Peptide

AF7654-BP 1mg
EUR 195

DAB1 cloning plasmid

CSB-CL006479HU1-10ug 10ug
EUR 574
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1662
  • Sequence: atgtcaactgagacagaacttcaagtagctgtgaaaaccagcgccaagaaagactccagaaagaaaggtcaggatcgcagtgaagccactttgataaagaggtttaaaggtgaaggggtccggtacaaagccaaattgatcgggattgatgaagtttccgcagctcggggagaca
  • Show more
Description: A cloning plasmid for the DAB1 gene.

DAB1 cloning plasmid

CSB-CL006479HU2-10ug 10ug
EUR 504
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1410
  • Sequence: atgtcaactgagacagaacttcaagtagctgtgaaaaccagcgccaagaaagactccagaaagaaaggtcaggatcgcagtgaagccactttgataaagaggtttaaaggtgaaggggtccggtacaaagccaaattgatcgggattgatgaagtttccgcagctcggggagaca
  • Show more
Description: A cloning plasmid for the DAB1 gene.

DAB1 cloning plasmid

CSB-CL006479HU3-10ug 10ug
EUR 562
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1614
  • Sequence: ATGTCAACTGAGACAGAACTTCAAGTAGCTGTGAAAACCAGCACCAAGAAAGACTCCAGAAAGAAAGGTCAGGATCGCAGTGAAGCCACTTTGATAAAGAGGTTTAAAGGTGAAGGGGTCCGGTACAAAGCCAAATTGATCGGGATTGATGAAGTTTCCGCAGCTCGGGGAGACA
  • Show more
Description: A cloning plasmid for the DAB1 gene.

Dab1 Polyclonal Antibody

ABP53957-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220
  • Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220

Dab1 Polyclonal Antibody

ABP53957-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220
  • Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220

Dab1 Polyclonal Antibody

ABP53957-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220
  • Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220

Dab1 Polyclonal Antibody

ABP51140-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232
  • Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232

Dab1 Polyclonal Antibody

ABP51140-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232
  • Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232

Dab1 Polyclonal Antibody

ABP51140-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232
  • Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232

Dab1 Polyclonal Antibody

ES4956-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Dab1 Polyclonal Antibody

ES4956-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Dab1 Polyclonal Antibody

ES2139-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Rat DAB1(Disabled Homolog 1) ELISA Kit

Scroll to Top