Rat DAB1(Disabled Homolog 1) ELISA Kit

Rat DAB1(Disabled Homolog 1) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Rat Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Ra-48Tests 48 Tests
EUR 557

Rat Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Ra-96Tests 96 Tests
EUR 775

Human Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Hu-48T 48T
EUR 517
  • Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Hu-96T 96T
EUR 673
  • Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Mu-48T 48T
EUR 527
  • Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Mu-96T 96T
EUR 688
  • Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit

RDR-DAB1-Hu-48Tests 48 Tests
EUR 544

Human Disabled Homolog 1 (DAB1) ELISA Kit

RDR-DAB1-Hu-96Tests 96 Tests
EUR 756

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

RDR-DAB1-Mu-48Tests 48 Tests
EUR 557

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

RDR-DAB1-Mu-96Tests 96 Tests
EUR 774

Human Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Hu-48Tests 48 Tests
EUR 521

Human Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Hu-96Tests 96 Tests
EUR 723

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Mu-48Tests 48 Tests
EUR 533

Mouse Disabled Homolog 1 (DAB1) ELISA Kit

RD-DAB1-Mu-96Tests 96 Tests
EUR 740

Rat Disabled Homolog 1 (DAB1) ELISA Kit

20-abx155443
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Disabled Homolog 1(DAB1)ELISA Kit

QY-E10335 96T
EUR 361

Rat Disabled Homolog 1 (DAB1) ELISA Kit

SEG171Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids.

Rat Disabled Homolog 1 (DAB1) ELISA Kit

SEG171Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids.

Rat Disabled Homolog 1 (DAB1) ELISA Kit

SEG171Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids.

Rat Disabled Homolog 1 (DAB1) ELISA Kit

SEG171Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids.

Rat Disabled Homolog 1 (DAB1) ELISA Kit

4-SEG171Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Disabled Homolog 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Disabled Homolog 1 (DAB1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Disabled Homolog 1 (DAB1) Protein

20-abx168517
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Disabled Homolog 1 (DAB1) Antibody

20-abx130098
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Disabled Homolog 1 (DAB1) Antibody

20-abx172135
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Disabled Homolog 1 (DAB1) Antibody

abx331920-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Disabled Homolog 1 (DAB1) Antibody

20-abx328081
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Disabled Homolog 1 (DAB1)

4-RPG171Ra01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8CJH2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Disabled Homolog 1 expressed in: E.coli

Rat Disabled Homolog 1 (DAB1) CLIA Kit

20-abx495119
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit

abx572870-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Rat DAB1 (Disabled Homolog 1)

ELK6761 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Disabled Homolog 1 (DAB1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Disabled
  • Show more
Description: A sandwich ELISA kit for detection of Disabled Homolog 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Disabled Homolog 1 (DAB1)ELISA Kit

201-12-2657 96 tests
EUR 440
  • This Disabled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Mouse Dab1/ Disabled homolog 1 ELISA Kit

E0377Mo 1 Kit
EUR 632

Human DAB1/ Disabled homolog 1 ELISA Kit

E0654Hu 1 Kit
EUR 605

Human DAB1(Disabled homolog 1) ELISA Kit

EH1419 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: O75553
  • Alias: DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Disabled homolog 1, DAB1 ELISA KIT

ELI-04118h 96 Tests
EUR 824

Mouse Disabled homolog 1, Dab1 ELISA KIT

ELI-04119m 96 Tests
EUR 865

Mouse Dab1(Disabled homolog 1) ELISA Kit

EM0551 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: P97318
  • Alias: Dab1/DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml

Human Disabled Homolog 1(DAB1)ELISA Kit

QY-E04976 96T
EUR 361

Mouse Disabled Homolog 1(DAB1)ELISA Kit

QY-E20475 96T
EUR 361

Dab1 ELISA Kit| Rat Disabled homolog 1 ELISA Kit

EF018591 96 Tests
EUR 689

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat)

4-PAG171Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1)

Disabled Homolog 1 (Drosophila) (DAB1) Antibody

20-abx009346
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Disabled Homolog 1 (Drosophila) (DAB1) Antibody

20-abx125745
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit

abx254902-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit

abx250694-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Dab1 ELISA Kit| Mouse Disabled homolog 1 ELISA Kit

EF013178 96 Tests
EUR 689

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), APC

4-PAG171Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with APC.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), Biotinylated

4-PAG171Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with Biotin.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), Cy3

4-PAG171Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with Cy3.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), FITC

4-PAG171Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with FITC.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), HRP

4-PAG171Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with HRP.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), PE

4-PAG171Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with PE.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), APC-Cy7

4-PAG171Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAB1 (Tyr42~Glu168)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with APC-Cy7.

Disabled Homolog 1 Phospho-Tyr232 (DAB1 pY232) Antibody

20-abx328082
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Mouse Disabled homolog 1

EK3038 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Disabled homolog 1

EK3039 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Dab1/ Rat Dab1 ELISA Kit

ELI-04117r 96 Tests
EUR 886

Recombinant human Disabled homolog 1

P1350 100ug Ask for price
  • Uniprot ID: O75553
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Disabled homolog 1

Human DAB2/ Disabled homolog 2 ELISA Kit

E0655Hu 1 Kit
EUR 571

ELISA kit for Human Disabled homolog 2

EK4306 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human DAB2(Disabled homolog 2) ELISA Kit

EH2115 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P98082
  • Alias: Disabled-2/DOC2/Differentially-expressed protein 2/disabled(Drosophila) homolog 2(mitogen-responsive phosphoprotein)/disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)/DOC-2DOC2
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Disabled homolog 2, Dab2 ELISA KIT

ELI-06819m 96 Tests
EUR 865

Human Disabled homolog 2, DAB2 ELISA KIT

ELI-06821h 96 Tests
EUR 824

Disabled Homolog 2 (DOC2) Antibody

abx224346-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Human Disabled homolog 2- interacting protein, DAB2IP ELISA KIT

ELI-07864h 96 Tests
EUR 824

Mouse Disabled homolog 2- interacting protein, Dab2ip ELISA KIT

ELI-32113m 96 Tests
EUR 865

Rat Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) ELISA Kit

abx519481-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Recombinant human Disabled homolog 2-interacting protein

P1522 100ug Ask for price
  • Uniprot ID: Q5VWQ8
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Disabled homolog 2-interacting protein

Anti-Dab1 (Ab-232) Antibody

A03459-1 100ul
EUR 397
Description: Rabbit Polyclonal Dab1 (Ab-232) Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Human DAB1 ELISA Kit

ELA-E12413h 96 Tests
EUR 824

DAB1 ELISA KIT|Human

EF004751 96 Tests
EUR 689

Dab1 Cell ELISA Kit

abx595170-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) ELISA Kit

abx251448-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) ELISA Kit

abx519480-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

20-abx002772
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

20-abx112096
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (Dab2) Antibody

abx031161-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (Dab2) Antibody

abx031161-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

abx034186-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

abx034186-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

20-abx242091
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

20-abx242092
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody

abx232228-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Rat DAB1 shRNA Plasmid

20-abx988097
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Dab1 Recombinant Protein (Rat)

RP197279 100 ug Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Rat Notch Homolog 1 ELISA kit

E02N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Notch Homolog 1 ELISA kit

E02N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Notch Homolog 1 ELISA kit

E02N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dab1 Colorimetric Cell-Based ELISA Kit

EKC1162 100ul
EUR 572

Dab1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6710302 1.0 ug DNA
EUR 154

Dab1 antibody

20R-2409 50 ug
EUR 281
Description: Rabbit polyclonal Dab1 antibody

DAB1 Antibody

1-CSB-PA002060
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DAB1. Recognizes DAB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

DAB1 antibody

70R-4084 50 ug
EUR 467
Description: Rabbit polyclonal DAB1 antibody

DAB1 antibody

70R-49648 100 ul
EUR 244
Description: Purified Polyclonal DAB1 antibody

Dab1 antibody

70R-34079 100 ug
EUR 327
Description: Rabbit polyclonal Dab1 antibody

Dab1 antibody

70R-34081 100 ug
EUR 327
Description: Rabbit polyclonal Dab1 antibody

Dab1 Antibody

AF6029 200ul
EUR 304
Description: Dab1 Antibody detects endogenous levels of total Dab1.

DAB1 siRNA

20-abx901401
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DAB1 siRNA

20-abx913525
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DAB1 siRNA

20-abx913526
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Dab1 Antibody

AF7654 200ul
EUR 376
Description: Dab1 Antibody detects endogenous levels of Dab1.

Dab1 Antibody

ABF6029 100 ug
EUR 438

anti-DAB1

YF-PA11270 50 ul
EUR 363
Description: Mouse polyclonal to DAB1

anti-DAB1

YF-PA11271 50 ug
EUR 363
Description: Mouse polyclonal to DAB1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

Rat TIMP-1 AssayMax ELISA Kit

ERT2538-1 96 Well Plate
EUR 477

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Dab1 ORF Vector (Rat) (pORF)

ORF065761 1.0 ug DNA
EUR 506

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody

A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Rat Slit Homolog 1 (Slit1) ELISA Kit

DLR-Slit1-Ra-48T 48T
EUR 549
  • Should the Rat Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit

DLR-Slit1-Ra-96T 96T
EUR 718
  • Should the Rat Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Protein pellino homolog 1 ELISA kit

E02P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein pellino homolog 1 ELISA kit

E02P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein pellino homolog 1 ELISA kit

E02P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crumbs homolog 1(CRB1) ELISA kit

E02C2038-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crumbs homolog 1(CRB1) ELISA kit

E02C2038-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crumbs homolog 1(CRB1) ELISA kit

E02C2038-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Achaete scute homolog 1 ELISA kit

E02A0079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Achaete scute homolog 1 ELISA kit

E02A0079-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Achaete scute homolog 1 ELISA kit

E02A0079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Slit Homolog 1 (Slit1) ELISA Kit

20-abx156095
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Dickkopf 1 Homolog (DKK1) ELISA Kit

20-abx155444
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Dickkopf 1 Homolog (DKK1) ELISA Kit

abx256873-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Robo1/ Roundabout homolog 1 ELISA Kit

E0848Ra 1 Kit
EUR 646

Rat Roundabout homolog 1, Robo1 ELISA KIT

ELI-42660r 96 Tests
EUR 886

Rat Nitrilase homolog 1 (NIT1) ELISA Kit

abx391718-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Roundabout homolog 1 (ROBO1) ELISA Kit

abx556264-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Frizzled Homolog 1 (FZD1) ELISA Kit

abx515257-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Frizzled Homolog 1(FZD1)ELISA Kit

GA-E0957RT-48T 48T
EUR 317

Rat Frizzled Homolog 1(FZD1)ELISA Kit

GA-E0957RT-96T 96T
EUR 496

Rat Frizzled Homolog 1(FZD1)ELISA Kit

QY-E10695 96T
EUR 361

Rat Slit Homolog 1 (Slit1) ELISA Kit

RD-Slit1-Ra-48Tests 48 Tests
EUR 557

Rat Slit Homolog 1 (Slit1) ELISA Kit

RD-Slit1-Ra-96Tests 96 Tests
EUR 775

Rat Slit Homolog 1 (Slit1) ELISA Kit

SED354Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit

SED354Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit

SED354Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit

SED354Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit

4-SED354Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Slit Homolog 1 elisa. Alternative names of the recognized antigen: MEGF4
  • SLIL1
  • SLIT3
  • Multiple epidermal growth factor-like domains protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Slit Homolog 1 (Slit1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Slit Homolog 1 (Slit1) ELISA Kit

RDR-Slit1-Ra-48Tests 48 Tests
EUR 583

Rat Slit Homolog 1 (Slit1) ELISA Kit

RDR-Slit1-Ra-96Tests 96 Tests
EUR 811

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Nit1 ELISA Kit| Rat Nitrilase homolog 1 ELISA Kit

EF019078 96 Tests
EUR 689

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

DAB1 Polyclonal Antibody

27390-100ul 100ul
EUR 252

DAB1 Polyclonal Antibody

27390-50ul 50ul
EUR 187

DAB1 Rabbit pAb

A10349-100ul 100 ul
EUR 308

DAB1 Rabbit pAb

A10349-200ul 200 ul
EUR 459

DAB1 Rabbit pAb

A10349-20ul 20 ul
EUR 183

DAB1 Rabbit pAb

A10349-50ul 50 ul
EUR 223

DAB1 Blocking Peptide

33R-7396 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DAB1 antibody, catalog no. 70R-4084

Dab1 antibody (Tyr232)

70R-34080 100 ug
EUR 327
Description: Rabbit polyclonal Dab1 antibody (Tyr232)

Dab1 (pY232) Antibody

abx010623-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

DAB1 Blocking Peptide

20-abx062523
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Dab1 Blocking Peptide

AF6029-BP 1mg
EUR 195

Dab1 Blocking Peptide

AF7654-BP 1mg
EUR 195

DAB1 cloning plasmid

CSB-CL006479HU1-10ug 10ug
EUR 574
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1662
  • Sequence: atgtcaactgagacagaacttcaagtagctgtgaaaaccagcgccaagaaagactccagaaagaaaggtcaggatcgcagtgaagccactttgataaagaggtttaaaggtgaaggggtccggtacaaagccaaattgatcgggattgatgaagtttccgcagctcggggagaca
  • Show more
Description: A cloning plasmid for the DAB1 gene.

DAB1 cloning plasmid

CSB-CL006479HU2-10ug 10ug
EUR 504
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1410
  • Sequence: atgtcaactgagacagaacttcaagtagctgtgaaaaccagcgccaagaaagactccagaaagaaaggtcaggatcgcagtgaagccactttgataaagaggtttaaaggtgaaggggtccggtacaaagccaaattgatcgggattgatgaagtttccgcagctcggggagaca
  • Show more
Description: A cloning plasmid for the DAB1 gene.

DAB1 cloning plasmid

CSB-CL006479HU3-10ug 10ug
EUR 562
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1614
  • Sequence: ATGTCAACTGAGACAGAACTTCAAGTAGCTGTGAAAACCAGCACCAAGAAAGACTCCAGAAAGAAAGGTCAGGATCGCAGTGAAGCCACTTTGATAAAGAGGTTTAAAGGTGAAGGGGTCCGGTACAAAGCCAAATTGATCGGGATTGATGAAGTTTCCGCAGCTCGGGGAGACA
  • Show more
Description: A cloning plasmid for the DAB1 gene.

Dab1 Polyclonal Antibody

ABP53957-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220
  • Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220

Dab1 Polyclonal Antibody

ABP53957-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220
  • Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220

Dab1 Polyclonal Antibody

ABP53957-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220
  • Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220

Dab1 Polyclonal Antibody

ABP51140-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232
  • Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232

Dab1 Polyclonal Antibody

ABP51140-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232
  • Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232

Dab1 Polyclonal Antibody

ABP51140-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232
  • Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232

Dab1 Polyclonal Antibody

ES4956-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Dab1 Polyclonal Antibody

ES4956-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Dab1 Polyclonal Antibody

ES2139-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Dab1 Polyclonal Antibody

ES2139-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

pCMV-SPORT6-DAB1

PVT14323 2 ug
EUR 495

Anti-DAB1 antibody

STJ112387 100 µl
EUR 277
Description: The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain.

Anti-Dab1 antibody

STJ92646 200 µl
EUR 197
Description: Rabbit polyclonal to Dab1.

Rat DAB1(Disabled Homolog 1) ELISA Kit

Scroll to Top