Rat DAB1(Disabled Homolog 1) ELISA Kit
To Order Contact us: mario@youngresearch.eu
Rat Disabled Homolog 1 (DAB1) ELISA Kit |
RD-DAB1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Disabled Homolog 1 (DAB1) ELISA Kit |
RD-DAB1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Disabled Homolog 1 (DAB1) ELISA Kit |
DLR-DAB1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
Human Disabled Homolog 1 (DAB1) ELISA Kit |
DLR-DAB1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
DLR-DAB1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
DLR-DAB1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
Human Disabled Homolog 1 (DAB1) ELISA Kit |
RDR-DAB1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Disabled Homolog 1 (DAB1) ELISA Kit |
RDR-DAB1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
RDR-DAB1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
RDR-DAB1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human Disabled Homolog 1 (DAB1) ELISA Kit |
RD-DAB1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Disabled Homolog 1 (DAB1) ELISA Kit |
RD-DAB1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
RD-DAB1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Disabled Homolog 1 (DAB1) ELISA Kit |
RD-DAB1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Disabled Homolog 1 (DAB1) ELISA Kit |
20-abx155443 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Disabled Homolog 1 (DAB1) ELISA Kit |
SEG171Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids. |
Rat Disabled Homolog 1 (DAB1) ELISA Kit |
SEG171Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids. |
Rat Disabled Homolog 1 (DAB1) ELISA Kit |
SEG171Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids. |
Rat Disabled Homolog 1 (DAB1) ELISA Kit |
SEG171Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids. |
Rat Disabled Homolog 1 (DAB1) ELISA Kit |
4-SEG171Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Disabled Homolog 1 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Disabled Homolog 1 (DAB1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Disabled Homolog 1 (DAB1) Protein |
20-abx168517 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2221.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Disabled Homolog 1 (DAB1) Antibody |
20-abx130098 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Disabled Homolog 1 (DAB1) Antibody |
20-abx172135 |
Abbexa |
|
|
|
Disabled Homolog 1 (DAB1) Antibody |
abx331920-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Disabled Homolog 1 (DAB1) Antibody |
20-abx328081 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Disabled Homolog 1 (DAB1) |
4-RPG171Ra01 |
Cloud-Clone |
-
EUR 512.16
-
EUR 240.00
-
EUR 1645.60
-
EUR 615.20
-
EUR 1130.40
-
EUR 406.00
-
EUR 3964.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8CJH2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 17.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Disabled Homolog 1 expressed in: E.coli |
Rat Disabled Homolog 1 (DAB1) CLIA Kit |
20-abx495119 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit |
abx572870-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat DAB1 (Disabled Homolog 1) |
ELK6761 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Disabled Homolog 1 (DAB1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Disabled
- Show more
|
Description: A sandwich ELISA kit for detection of Disabled Homolog 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Disabled Homolog 1 (DAB1)ELISA Kit |
201-12-2657 |
SunredBio |
96 tests |
EUR 440 |
- This Disabled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Mouse Dab1/ Disabled homolog 1 ELISA Kit |
E0377Mo |
Sunlong |
1 Kit |
EUR 632 |
Human DAB1/ Disabled homolog 1 ELISA Kit |
E0654Hu |
Sunlong |
1 Kit |
EUR 605 |
Human DAB1(Disabled homolog 1) ELISA Kit |
EH1419 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: O75553
- Alias: DAB1/Disabled homolog 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Mouse Dab1(Disabled homolog 1) ELISA Kit |
EM0551 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.78-50 ng/ml
- Uniprot ID: P97318
- Alias: Dab1/DAB1/Disabled homolog 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml |
Dab1 ELISA Kit| Rat Disabled homolog 1 ELISA Kit |
EF018591 |
Lifescience Market |
96 Tests |
EUR 689 |
Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat) |
4-PAG171Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DAB1 (Tyr42~Glu168)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1) |
Disabled Homolog 1 (Drosophila) (DAB1) Antibody |
20-abx009346 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Disabled Homolog 1 (Drosophila) (DAB1) Antibody |
20-abx125745 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Mouse Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit |
abx254902-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit |
abx250694-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Dab1 ELISA Kit| Mouse Disabled homolog 1 ELISA Kit |
EF013178 |
Lifescience Market |
96 Tests |
EUR 689 |
Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), APC |
4-PAG171Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DAB1 (Tyr42~Glu168)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with APC. |
Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), Biotinylated |
4-PAG171Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DAB1 (Tyr42~Glu168)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with Biotin. |
Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), Cy3 |
4-PAG171Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DAB1 (Tyr42~Glu168)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with Cy3. |
Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), FITC |
4-PAG171Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DAB1 (Tyr42~Glu168)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with FITC. |
Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), HRP |
4-PAG171Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DAB1 (Tyr42~Glu168)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with HRP. |
Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), PE |
4-PAG171Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DAB1 (Tyr42~Glu168)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with PE. |
Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAG171Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DAB1 (Tyr42~Glu168)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with APC-Cy7. |
Disabled Homolog 1 Phospho-Tyr232 (DAB1 pY232) Antibody |
20-abx328082 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELISA kit for Mouse Disabled homolog 1 |
EK3038 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Disabled homolog 1 |
EK3039 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Recombinant human Disabled homolog 1 |
P1350 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: O75553
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Disabled homolog 1 |
Human DAB2/ Disabled homolog 2 ELISA Kit |
E0655Hu |
Sunlong |
1 Kit |
EUR 571 |
ELISA kit for Human Disabled homolog 2 |
EK4306 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 2 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human DAB2(Disabled homolog 2) ELISA Kit |
EH2115 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P98082
- Alias: Disabled-2/DOC2/Differentially-expressed protein 2/disabled(Drosophila) homolog 2(mitogen-responsive phosphoprotein)/disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)/DOC-2DOC2
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Disabled Homolog 2 (DOC2) Antibody |
abx224346-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Human Disabled homolog 2- interacting protein, DAB2IP ELISA KIT |
ELI-07864h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Disabled homolog 2- interacting protein, Dab2ip ELISA KIT |
ELI-32113m |
Lifescience Market |
96 Tests |
EUR 865 |
Rat Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) ELISA Kit |
abx519481-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
DAB1 ELISA Kit (Rat) (OKCD02379) |
OKCD02379 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: Adapter molecule functioning in neural development. May regulate SIAH1 activity. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.107 ng/mL |
Recombinant human Disabled homolog 2-interacting protein |
P1522 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q5VWQ8
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Disabled homolog 2-interacting protein |
Anti-Dab1 (Ab-232) Antibody |
A03459-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Dab1 (Ab-232) Antibody. Validated in IHC and tested in Human, Mouse, Rat. |
Dab1 Cell ELISA Kit |
abx595170-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Human Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) ELISA Kit |
abx251448-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) ELISA Kit |
abx519480-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody |
20-abx002772 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody |
20-abx112096 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (Dab2) Antibody |
abx031161-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (Dab2) Antibody |
abx031161-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody |
abx034186-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody |
abx034186-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody |
20-abx242091 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody |
20-abx242092 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody |
abx232228-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
Rat DAB1 shRNA Plasmid |
20-abx988097 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Dab1 Recombinant Protein (Rat) |
RP197279 |
ABM |
100 ug |
Ask for price |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Rat Notch Homolog 1 ELISA kit |
E02N0594-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Notch Homolog 1 ELISA kit |
E02N0594-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Notch Homolog 1 ELISA kit |
E02N0594-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dab1 Colorimetric Cell-Based ELISA Kit |
EKC1162 |
BosterBio |
100ul |
EUR 572 |
Dab1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6710302 |
ABM |
1.0 ug DNA |
EUR 154 |
Dab1 antibody |
20R-2409 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal Dab1 antibody |
DAB1 Antibody |
1-CSB-PA002060 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against DAB1. Recognizes DAB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000 |
DAB1 antibody |
70R-4084 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DAB1 antibody |
DAB1 antibody |
70R-49648 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal DAB1 antibody |
Dab1 antibody |
70R-34079 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal Dab1 antibody |
Dab1 antibody |
70R-34081 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal Dab1 antibody |
Dab1 Antibody |
AF6029 |
Affbiotech |
200ul |
EUR 304 |
Description: Dab1 Antibody detects endogenous levels of total Dab1. |
DAB1 siRNA |
20-abx901401 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DAB1 siRNA |
20-abx913525 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DAB1 siRNA |
20-abx913526 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dab1 Antibody |
AF7654 |
Affbiotech |
200ul |
EUR 376 |
Description: Dab1 Antibody detects endogenous levels of Dab1. |
anti-DAB1 |
YF-PA11270 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to DAB1 |
anti-DAB1 |
YF-PA11271 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to DAB1 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Dab1 ORF Vector (Rat) (pORF) |
ORF065761 |
ABM |
1.0 ug DNA |
EUR 506 |
Rat TIMP-1 AssayMax ELISA Kit |
ERT2538-1 |
AssayPro |
96 Well Plate |
EUR 477 |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Anti-CELSR3/Flamingo Homolog 1 Antibody |
A07204-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat. |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
Rat Slit Homolog 1 (Slit1) ELISA Kit |
DLR-Slit1-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Slit Homolog 1 (Slit1) ELISA Kit |
DLR-Slit1-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Protein pellino homolog 1 ELISA kit |
E02P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Protein pellino homolog 1 ELISA kit |
E02P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Protein pellino homolog 1 ELISA kit |
E02P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Crumbs homolog 1(CRB1) ELISA kit |
E02C2038-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Crumbs homolog 1(CRB1) ELISA kit |
E02C2038-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Crumbs homolog 1(CRB1) ELISA kit |
E02C2038-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Achaete scute homolog 1 ELISA kit |
E02A0079-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Achaete scute homolog 1 ELISA kit |
E02A0079-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Achaete scute homolog 1 ELISA kit |
E02A0079-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Slit Homolog 1 (Slit1) ELISA Kit |
20-abx156095 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Dickkopf 1 Homolog (DKK1) ELISA Kit |
20-abx155444 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Dickkopf 1 Homolog (DKK1) ELISA Kit |
abx256873-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Rat Robo1/ Roundabout homolog 1 ELISA Kit |
E0848Ra |
Sunlong |
1 Kit |
EUR 646 |
Rat Nitrilase homolog 1 (NIT1) ELISA Kit |
abx391718-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Roundabout homolog 1 (ROBO1) ELISA Kit |
abx556264-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Frizzled Homolog 1 (FZD1) ELISA Kit |
abx515257-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Frizzled Homolog 1(FZD1)ELISA Kit |
GA-E0957RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat Frizzled Homolog 1(FZD1)ELISA Kit |
GA-E0957RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
Rat Slit Homolog 1 (Slit1) ELISA Kit |
RD-Slit1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Slit Homolog 1 (Slit1) ELISA Kit |
RD-Slit1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Rat Slit Homolog 1 (Slit1) ELISA Kit |
SED354Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Slit Homolog 1 (Slit1) ELISA Kit |
SED354Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Slit Homolog 1 (Slit1) ELISA Kit |
SED354Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Slit Homolog 1 (Slit1) ELISA Kit |
SED354Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Slit Homolog 1 (Slit1) ELISA Kit |
4-SED354Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Slit Homolog 1 elisa. Alternative names of the recognized antigen: MEGF4
- SLIL1
- SLIT3
- Multiple epidermal growth factor-like domains protein 4
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Slit Homolog 1 (Slit1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Slit Homolog 1 (Slit1) ELISA Kit |
RDR-Slit1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Slit Homolog 1 (Slit1) ELISA Kit |
RDR-Slit1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Dab1 Colorimetric Cell-Based ELISA Kit (OKAG00660) |
OKAG00660 |
Aviva Systems Biology |
96 Wells |
EUR 596 |
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity: |
DAB1 ELISA Kit (Human) : 96 Wells (OKEH02231) |
OKEH02231 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.093 ng/mL |
DAB1 ELISA Kit (Mouse) : 96 Wells (OKEH02232) |
OKEH02232 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39 ng/mL |
Nit1 ELISA Kit| Rat Nitrilase homolog 1 ELISA Kit |
EF019078 |
Lifescience Market |
96 Tests |
EUR 689 |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
DAB1 Polyclonal Antibody |
27390-100ul |
SAB |
100ul |
EUR 252 |
DAB1 Polyclonal Antibody |
27390-50ul |
SAB |
50ul |
EUR 187 |
DAB1 Rabbit pAb |
A10349-100ul |
Abclonal |
100 ul |
EUR 308 |
DAB1 Rabbit pAb |
A10349-200ul |
Abclonal |
200 ul |
EUR 459 |
DAB1 Rabbit pAb |
A10349-20ul |
Abclonal |
20 ul |
EUR 183 |
DAB1 Rabbit pAb |
A10349-50ul |
Abclonal |
50 ul |
EUR 223 |
DAB1 Blocking Peptide |
33R-7396 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DAB1 antibody, catalog no. 70R-4084 |
Dab1 antibody (Tyr232) |
70R-34080 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal Dab1 antibody (Tyr232) |
Dab1 (pY232) Antibody |
abx010623-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
DAB1 Blocking Peptide |
20-abx062523 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dab1 Blocking Peptide |
AF6029-BP |
Affbiotech |
1mg |
EUR 195 |
Dab1 Blocking Peptide |
AF7654-BP |
Affbiotech |
1mg |
EUR 195 |
DAB1 cloning plasmid |
CSB-CL006479HU1-10ug |
Cusabio |
10ug |
EUR 574 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1662
- Sequence: atgtcaactgagacagaacttcaagtagctgtgaaaaccagcgccaagaaagactccagaaagaaaggtcaggatcgcagtgaagccactttgataaagaggtttaaaggtgaaggggtccggtacaaagccaaattgatcgggattgatgaagtttccgcagctcggggagaca
- Show more
|
Description: A cloning plasmid for the DAB1 gene. |
DAB1 cloning plasmid |
CSB-CL006479HU2-10ug |
Cusabio |
10ug |
EUR 504 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1410
- Sequence: atgtcaactgagacagaacttcaagtagctgtgaaaaccagcgccaagaaagactccagaaagaaaggtcaggatcgcagtgaagccactttgataaagaggtttaaaggtgaaggggtccggtacaaagccaaattgatcgggattgatgaagtttccgcagctcggggagaca
- Show more
|
Description: A cloning plasmid for the DAB1 gene. |
DAB1 cloning plasmid |
CSB-CL006479HU3-10ug |
Cusabio |
10ug |
EUR 562 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1614
- Sequence: ATGTCAACTGAGACAGAACTTCAAGTAGCTGTGAAAACCAGCACCAAGAAAGACTCCAGAAAGAAAGGTCAGGATCGCAGTGAAGCCACTTTGATAAAGAGGTTTAAAGGTGAAGGGGTCCGGTACAAAGCCAAATTGATCGGGATTGATGAAGTTTCCGCAGCTCGGGGAGACA
- Show more
|
Description: A cloning plasmid for the DAB1 gene. |
Dab1 Polyclonal Antibody |
ABP53957-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220
- Applications tips:
|
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220 |
Dab1 Polyclonal Antibody |
ABP53957-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220
- Applications tips:
|
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220 |
Dab1 Polyclonal Antibody |
ABP53957-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220
- Applications tips:
|
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220 |
Dab1 Polyclonal Antibody |
ABP51140-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232
- Applications tips:
|
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232 |
Dab1 Polyclonal Antibody |
ABP51140-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232
- Applications tips:
|
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232 |
Dab1 Polyclonal Antibody |
ABP51140-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232
- Applications tips:
|
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232 |
Dab1 Polyclonal Antibody |
ES4956-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA |
Dab1 Polyclonal Antibody |
ES4956-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA |
Dab1 Polyclonal Antibody |
ES2139-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA |
Rat DAB1(Disabled Homolog 1) ELISA Kit