Rat DAB1(Disabled Homolog 1) ELISA Kit

Rat DAB1(Disabled Homolog 1) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Rat Disabled Homolog 1 (DAB1) ELISA Kit
RD-DAB1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Disabled Homolog 1 (DAB1) ELISA Kit
RD-DAB1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Mouse Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Mouse Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit
RDR-DAB1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Disabled Homolog 1 (DAB1) ELISA Kit
RDR-DAB1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Disabled Homolog 1 (DAB1) ELISA Kit
RDR-DAB1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Disabled Homolog 1 (DAB1) ELISA Kit
RDR-DAB1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Disabled Homolog 1 (DAB1) ELISA Kit
RD-DAB1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Disabled Homolog 1 (DAB1) ELISA Kit
RD-DAB1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Disabled Homolog 1 (DAB1) ELISA Kit
RD-DAB1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Disabled Homolog 1 (DAB1) ELISA Kit
RD-DAB1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Disabled Homolog 1 (DAB1) ELISA Kit
20-abx155443	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Disabled Homolog 1(DAB1)ELISA Kit
QY-E10335	Qayee Biotechnology	96T	EUR 361

Rat Disabled Homolog 1 (DAB1) ELISA Kit
SEG171Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids.

Rat Disabled Homolog 1 (DAB1) ELISA Kit
SEG171Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids.

Rat Disabled Homolog 1 (DAB1) ELISA Kit
SEG171Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids.

Rat Disabled Homolog 1 (DAB1) ELISA Kit
SEG171Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Disabled Homolog 1 (DAB1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Disabled Homolog 1 (DAB1) in Tissue homogenates and other biological fluids.

Rat Disabled Homolog 1 (DAB1) ELISA Kit
4-SEG171Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Disabled Homolog 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Disabled Homolog 1 (DAB1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Disabled Homolog 1 (DAB1) Protein
20-abx168517	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Disabled Homolog 1 (DAB1) Antibody
20-abx130098	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Disabled Homolog 1 (DAB1) Antibody
20-abx172135	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Disabled Homolog 1 (DAB1) Antibody
20-abx328081	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Disabled Homolog 1 (DAB1) Antibody
abx331920-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Recombinant Disabled Homolog 1 (DAB1)
4-RPG171Ra01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8CJH2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.9kDa Isoelectric Point: Inquire
Description: Recombinant Rat Disabled Homolog 1 expressed in: E.coli

Rat Disabled Homolog 1 (DAB1) CLIA Kit
20-abx495119	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit
abx572870-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Rat DAB1 (Disabled Homolog 1)
ELK6761	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Disabled Homolog 1 (DAB1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Disabled Show more
Description: A sandwich ELISA kit for detection of Disabled Homolog 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human DAB1/ Disabled homolog 1 ELISA Kit
E0654Hu	Sunlong	1 Kit	EUR 605

Mouse Dab1/ Disabled homolog 1 ELISA Kit
E0377Mo	Sunlong	1 Kit	EUR 632

Human DAB1(Disabled homolog 1) ELISA Kit
EH1419	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: O75553 Alias: DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Disabled homolog 1, DAB1 ELISA KIT
ELI-04118h	Lifescience Market	96 Tests	EUR 824

Mouse Disabled homolog 1, Dab1 ELISA KIT
ELI-04119m	Lifescience Market	96 Tests	EUR 865

Mouse Dab1(Disabled homolog 1) ELISA Kit
EM0551	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: P97318 Alias: Dab1/DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml

Human Disabled Homolog 1 (DAB1)ELISA Kit
201-12-2657	SunredBio	96 tests	EUR 440
This Disabled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Disabled Homolog 1(DAB1)ELISA Kit
QY-E04976	Qayee Biotechnology	96T	EUR 361

Mouse Disabled Homolog 1(DAB1)ELISA Kit
QY-E20475	Qayee Biotechnology	96T	EUR 361

Dab1 ELISA Kit| Rat Disabled homolog 1 ELISA Kit
EF018591	Lifescience Market	96 Tests	EUR 689

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat)
4-PAG171Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DAB1 (Tyr42~Glu168) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1)

Disabled Homolog 1 (Drosophila) (DAB1) Antibody
20-abx125745	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Disabled Homolog 1 (Drosophila) (DAB1) Antibody
20-abx009346	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Mouse Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit
abx254902-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Disabled Homolog 1, (Drosophila) (DAB1) ELISA Kit
abx250694-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Dab1 ELISA Kit| Mouse Disabled homolog 1 ELISA Kit
EF013178	Lifescience Market	96 Tests	EUR 689

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), APC
4-PAG171Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DAB1 (Tyr42~Glu168) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with APC.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), Biotinylated
4-PAG171Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DAB1 (Tyr42~Glu168) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with Biotin.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), Cy3
4-PAG171Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DAB1 (Tyr42~Glu168) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with Cy3.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), FITC
4-PAG171Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DAB1 (Tyr42~Glu168) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with FITC.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), HRP
4-PAG171Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DAB1 (Tyr42~Glu168) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with HRP.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), PE
4-PAG171Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DAB1 (Tyr42~Glu168) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with PE.

Disabled Homolog 1 (DAB1) Polyclonal Antibody (Rat), APC-Cy7
4-PAG171Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DAB1 (Tyr42~Glu168) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Disabled Homolog 1 (DAB1). This antibody is labeled with APC-Cy7.

Disabled Homolog 1 Phospho-Tyr232 (DAB1 pY232) Antibody
20-abx328082	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Mouse Disabled homolog 1
EK3038	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Disabled homolog 1
EK3039	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Recombinant human Disabled homolog 1
P1350	FN Test	100ug	Ask for price
Uniprot ID: O75553 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Disabled homolog 1

Dab1/ Rat Dab1 ELISA Kit
ELI-04117r	Lifescience Market	96 Tests	EUR 886

Human DAB2/ Disabled homolog 2 ELISA Kit
E0655Hu	Sunlong	1 Kit	EUR 571

ELISA kit for Human Disabled homolog 2
EK4306	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human DAB2(Disabled homolog 2) ELISA Kit
EH2115	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P98082 Alias: Disabled-2/DOC2/Differentially-expressed protein 2/disabled(Drosophila) homolog 2(mitogen-responsive phosphoprotein)/disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)/DOC-2DOC2 Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Disabled homolog 2, Dab2 ELISA KIT
ELI-06819m	Lifescience Market	96 Tests	EUR 865

Human Disabled homolog 2, DAB2 ELISA KIT
ELI-06821h	Lifescience Market	96 Tests	EUR 824

Disabled Homolog 2 (DOC2) Antibody
abx224346-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Human Disabled homolog 2- interacting protein, DAB2IP ELISA KIT
ELI-07864h	Lifescience Market	96 Tests	EUR 824

Mouse Disabled homolog 2- interacting protein, Dab2ip ELISA KIT
ELI-32113m	Lifescience Market	96 Tests	EUR 865

Rat Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) ELISA Kit
abx519481-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

DAB1 ELISA Kit (Rat) (OKCD02379)
OKCD02379	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: Adapter molecule functioning in neural development. May regulate SIAH1 activity. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.107 ng/mL

Recombinant human Disabled homolog 2-interacting protein
P1522	FN Test	100ug	Ask for price
Uniprot ID: Q5VWQ8 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Disabled homolog 2-interacting protein

Anti-Dab1 (Ab-232) Antibody
A03459-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Dab1 (Ab-232) Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Dab1 Cell ELISA Kit
abx595170-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Human DAB1 ELISA Kit
ELA-E12413h	Lifescience Market	96 Tests	EUR 824

DAB1 ELISA KIT|Human
EF004751	Lifescience Market	96 Tests	EUR 689

Mouse Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) ELISA Kit
abx519480-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) ELISA Kit
abx251448-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody
20-abx112096	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody
20-abx002772	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody
abx034186-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody
abx034186-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (Dab2) Antibody
abx031161-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (Dab2) Antibody
abx031161-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody
20-abx242091	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody
20-abx242092	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Disabled Homolog 2, Mitogen-Responsive Phosphoprotein (Drosophila) (DAB2) Antibody
abx232228-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Rat DAB1 shRNA Plasmid
20-abx988097	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Dab1 Recombinant Protein (Rat)
RP197279	ABM	100 ug	Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Rat Notch Homolog 1 ELISA kit
E02N0594-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Notch Homolog 1 ELISA kit
E02N0594-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Notch Homolog 1 ELISA kit
E02N0594-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dab1 Colorimetric Cell-Based ELISA Kit
EKC1162	BosterBio	100ul	EUR 572

Dab1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6710302	ABM	1.0 ug DNA	EUR 154

Dab1 Antibody
AF6029	Affbiotech	200ul	EUR 304
Description: Dab1 Antibody detects endogenous levels of total Dab1.

DAB1 siRNA
20-abx901401	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Dab1 Antibody
AF7654	Affbiotech	200ul	EUR 376
Description: Dab1 Antibody detects endogenous levels of Dab1.

Dab1 Antibody
ABF6029	Lifescience Market	100 ug	EUR 438

DAB1 siRNA
20-abx913525	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DAB1 siRNA
20-abx913526	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DAB1 antibody
70R-49648	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal DAB1 antibody

DAB1 antibody
70R-4084	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DAB1 antibody

Dab1 antibody
70R-34079	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Dab1 antibody

Dab1 antibody
70R-34081	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Dab1 antibody

Dab1 antibody
20R-2409	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal Dab1 antibody

DAB1 Antibody
1-CSB-PA002060	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DAB1. Recognizes DAB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

anti-DAB1
YF-PA11270	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to DAB1

anti-DAB1
YF-PA11271	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to DAB1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Dab1 ORF Vector (Rat) (pORF)
ORF065761	ABM	1.0 ug DNA	EUR 506

Anti-CELSR3/Flamingo Homolog 1 Antibody
A07204-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Rat TIMP-1 AssayMax ELISA Kit
ERT2538-1	AssayPro	96 Well Plate	EUR 477

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Rat Roundabout homolog 1 (ROBO1) ELISA Kit
abx556264-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Frizzled Homolog 1 (FZD1) ELISA Kit
abx515257-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Achaete scute homolog 1 ELISA kit
E02A0079-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Achaete scute homolog 1 ELISA kit
E02A0079-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Achaete scute homolog 1 ELISA kit
E02A0079-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crumbs homolog 1(CRB1) ELISA kit
E02C2038-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crumbs homolog 1(CRB1) ELISA kit
E02C2038-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Crumbs homolog 1(CRB1) ELISA kit
E02C2038-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein pellino homolog 1 ELISA kit
E02P0173-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein pellino homolog 1 ELISA kit
E02P0173-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein pellino homolog 1 ELISA kit
E02P0173-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Robo1/ Roundabout homolog 1 ELISA Kit
E0848Ra	Sunlong	1 Kit	EUR 646

Rat Frizzled Homolog 1(FZD1)ELISA Kit
GA-E0957RT-48T	GenAsia Biotech	48T	EUR 317

Rat Frizzled Homolog 1(FZD1)ELISA Kit
GA-E0957RT-96T	GenAsia Biotech	96T	EUR 496

Rat Roundabout homolog 1, Robo1 ELISA KIT
ELI-42660r	Lifescience Market	96 Tests	EUR 886

Rat Slit Homolog 1 (Slit1) ELISA Kit
20-abx156095	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Dickkopf 1 Homolog (DKK1) ELISA Kit
20-abx155444	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Dickkopf 1 Homolog (DKK1) ELISA Kit
abx256873-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat Nitrilase homolog 1 (NIT1) ELISA Kit
abx391718-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit
RD-Slit1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Slit Homolog 1 (Slit1) ELISA Kit
RD-Slit1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Rat Slit Homolog 1 (Slit1) ELISA Kit
RDR-Slit1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Slit Homolog 1 (Slit1) ELISA Kit
RDR-Slit1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Rat Frizzled Homolog 1(FZD1)ELISA Kit
QY-E10695	Qayee Biotechnology	96T	EUR 361

Rat Slit Homolog 1 (Slit1) ELISA Kit
SED354Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit
SED354Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit
SED354Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit
SED354Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Slit Homolog 1 (Slit1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Slit Homolog 1 (Slit1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Slit Homolog 1 (Slit1) ELISA Kit
4-SED354Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Slit Homolog 1 elisa. Alternative names of the recognized antigen: MEGF4 SLIL1 SLIT3 Multiple epidermal growth factor-like domains protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Slit Homolog 1 (Slit1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Dab1 Colorimetric Cell-Based ELISA Kit (OKAG00660)
OKAG00660	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity:

DAB1 ELISA Kit (Human) : 96 Wells (OKEH02231)
OKEH02231	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.093 ng/mL

DAB1 ELISA Kit (Mouse) : 96 Wells (OKEH02232)
OKEH02232	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39 ng/mL

Nit1 ELISA Kit| Rat Nitrilase homolog 1 ELISA Kit
EF019078	Lifescience Market	96 Tests	EUR 689

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Dab1 Blocking Peptide
AF6029-BP	Affbiotech	1mg	EUR 195

Dab1 Blocking Peptide
AF7654-BP	Affbiotech	1mg	EUR 195

DAB1 cloning plasmid
CSB-CL006479HU1-10ug	Cusabio	10ug	EUR 574
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1662 Sequence: atgtcaactgagacagaacttcaagtagctgtgaaaaccagcgccaagaaagactccagaaagaaaggtcaggatcgcagtgaagccactttgataaagaggtttaaaggtgaaggggtccggtacaaagccaaattgatcgggattgatgaagtttccgcagctcggggagaca Show more
Description: A cloning plasmid for the DAB1 gene.

DAB1 cloning plasmid
CSB-CL006479HU2-10ug	Cusabio	10ug	EUR 504
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1410 Sequence: atgtcaactgagacagaacttcaagtagctgtgaaaaccagcgccaagaaagactccagaaagaaaggtcaggatcgcagtgaagccactttgataaagaggtttaaaggtgaaggggtccggtacaaagccaaattgatcgggattgatgaagtttccgcagctcggggagaca Show more
Description: A cloning plasmid for the DAB1 gene.

DAB1 cloning plasmid
CSB-CL006479HU3-10ug	Cusabio	10ug	EUR 562
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1614 Sequence: ATGTCAACTGAGACAGAACTTCAAGTAGCTGTGAAAACCAGCACCAAGAAAGACTCCAGAAAGAAAGGTCAGGATCGCAGTGAAGCCACTTTGATAAAGAGGTTTAAAGGTGAAGGGGTCCGGTACAAAGCCAAATTGATCGGGATTGATGAAGTTTCCGCAGCTCGGGGAGACA Show more
Description: A cloning plasmid for the DAB1 gene.

Dab1 Polyclonal Antibody
ES2139-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Dab1 Polyclonal Antibody
ES2139-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Dab1 Polyclonal Antibody
ES4956-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Dab1 Polyclonal Antibody
ES4956-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Dab1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

DAB1 Blocking Peptide
20-abx062523	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Dab1 Polyclonal Antibody
ABP51140-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232 Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232

Dab1 Polyclonal Antibody
ABP51140-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232 Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232

Dab1 Polyclonal Antibody
ABP51140-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232 Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y232

Dab1 (pY232) Antibody
abx010623-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Dab1 Polyclonal Antibody
ABP53957-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220 Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220

Dab1 Polyclonal Antibody
ABP53957-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220 Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220

Dab1 Polyclonal Antibody
ABP53957-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220 Applications tips:
Description: A polyclonal antibody for detection of Dab1 from Human, Mouse, Rat. This Dab1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dab1 around the non-phosphorylation site of Y220

DAB1 Rabbit pAb
A10349-100ul	Abclonal	100 ul	EUR 308

DAB1 Rabbit pAb
A10349-200ul	Abclonal	200 ul	EUR 459

DAB1 Rabbit pAb
A10349-20ul	Abclonal	20 ul	EUR 183

DAB1 Rabbit pAb
A10349-50ul	Abclonal	50 ul	EUR 223

Dab1 antibody (Tyr232)
70R-34080	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Dab1 antibody (Tyr232)

DAB1 Blocking Peptide
33R-7396	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DAB1 antibody, catalog no. 70R-4084

DAB1 Polyclonal Antibody
27390-100ul	SAB	100ul	EUR 252

Rat DAB1(Disabled Homolog 1) ELISA Kit