Human SEMA5A(Semaphorin 5A) ELISA Kit

Human SEMA5A(Semaphorin 5A) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Human Semaphorin 5A (SEMA5A) ELISA Kit
RDR-SEMA5A-Hu-96Tests 96 Tests
EUR 820
Human Semaphorin 5A (SEMA5A)ELISA Kit
201-12-1946 96 tests
EUR 440
  • This Semaphorin 5A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Semaphorin 5A (SEMA5A) ELISA Kit
20-abx153053
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Semaphorin 5A (SEMA5A) ELISA Kit
abx251082-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Human SEMA5A/ Semaphorin-5A ELISA Kit
E2240Hu 1 Kit
EUR 571
Human SEMA5A(Semaphorin-5A) ELISA Kit
EH1776 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q13591
  • Alias: SEMA5A/Semaphorin-5A/Semaphorin-F/Sema F/SEMAF/semaphorin F/SEMF/transmembrane domain(TM) and short cytoplasmic domain,(semaphorin) 5A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Semaphorin- 5A, SEMA5A ELISA KIT
ELI-04993h 96 Tests
EUR 824
Human Semaphorin 5A (SEMA5A) ELISA Kit
abx573582-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Semaphorin 5A(SEMA5A)ELISA Kit
GA-E1962HM-48T 48T
EUR 289
Human Semaphorin 5A(SEMA5A)ELISA Kit
GA-E1962HM-96T 96T
EUR 466
Human Semaphorin 5A(SEMA5A)ELISA Kit
QY-E00790 96T
EUR 361
Human Semaphorin 5A ELISA Kit (SEMA5A)
RK02265 96 Tests
EUR 521
Human Semaphorin 5A (SEMA5A) ELISA Kit
SEL924Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5A (SEMA5A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5A (SEMA5A) in tissue homogenates, cell lysates and other biological fluids.
Human Semaphorin 5A (SEMA5A) ELISA Kit
SEL924Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5A (SEMA5A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5A (SEMA5A) in tissue homogenates, cell lysates and other biological fluids.
Human Semaphorin 5A (SEMA5A) ELISA Kit
SEL924Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5A (SEMA5A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5A (SEMA5A) in tissue homogenates, cell lysates and other biological fluids.
Human Semaphorin 5A (SEMA5A) ELISA Kit
SEL924Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5A (SEMA5A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5A (SEMA5A) in tissue homogenates, cell lysates and other biological fluids.
Human Semaphorin 5A (SEMA5A) ELISA Kit
4-SEL924Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Semaphorin 5A elisa. Alternative names of the recognized antigen: SEMAF
  • SemF
  • Semaphorin-F
  • Sema Domain, Immunoglobulin Domain(Ig), Transmembrane Domain(TM)and Short Cytoplasmic Domain 5A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Semaphorin 5A (SEMA5A) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Semaphorin 5A (SEMA5A) Antibody
20-abx178355
  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.
Semaphorin 5A (SEMA5A) Antibody
20-abx174506
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Semaphorin 5A (SEMA5A) Antibody
abx031646-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Semaphorin 5A (SEMA5A) Antibody
abx031646-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Semaphorin 5A (SEMA5A) Antibody
abx431581-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Semaphorin 5A (SEMA5A) Antibody
20-abx306749
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse Semaphorin- 5A, Sema5a ELISA KIT
ELI-04992m 96 Tests
EUR 865
Mouse Semaphorin 5A (SEMA5A) ELISA Kit
abx517654-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Semaphorin 5A (SEMA5A) Protein
20-abx655031
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Human Semaphorin 5A (SEMA5A) CLIA Kit
20-abx495991
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human SEMA5A (Semaphorin 5A)
ELK6672 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Semaphorin 5A (SEMA5A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Semaphorin
  • Show more
Description: A sandwich ELISA kit for detection of Semaphorin 5A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Semaphorin-5A (SEMA5A)
KTE62333-48T 48T
EUR 332
  • SEMA5A belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Semaphorin-5A (SEMA5A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Semaphorin-5A (SEMA5A)
KTE62333-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SEMA5A belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Semaphorin-5A (SEMA5A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Semaphorin-5A (SEMA5A)
KTE62333-96T 96T
EUR 539
  • SEMA5A belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Semaphorin-5A (SEMA5A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Semaphorin 5A (SEMA5A) Antibody (HRP)
20-abx306750
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Semaphorin 5A (SEMA5A) Antibody (FITC)
20-abx306751
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Semaphorin 5A (SEMA5A) Antibody (Biotin)
20-abx306752
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant Human Semaphorin-5A/SEMA5A (C-6His)
C499-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 0.1mM EDTA, 0.05% Tween 20, pH 7.2.
Recombinant Human Semaphorin-5A/SEMA5A (C-6His)
C499-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 0.1mM EDTA, 0.05% Tween 20, pH 7.2.
Recombinant Human Semaphorin-5A/SEMA5A (C-6His)
C499-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 0.1mM EDTA, 0.05% Tween 20, pH 7.2.
Recombinant Human Semaphorin-5A/SEMA5A (C-6His)
C499-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 0.1mM EDTA, 0.05% Tween 20, pH 7.2.
Semaphorin 5A
GT41026 100 ug
EUR 474
Semaphorin 5A
P41026 100 ug Blocking Peptide
EUR 239
Recombinant Human Semaphorin-5A Protein
RP01093 10 μg
EUR 190
Polyclonal Semaphorin 5A Antibody
APR13260G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Semaphorin 5A . This antibody is tested and proven to work in the following applications:
Anti-Semaphorin 5A antibody
STJ70970 100 µg
EUR 359
anti-Anti-Semaphorin 5A
YF-PA25252 50 ul
EUR 334
Description: Mouse polyclonal to Anti-Semaphorin 5A
Human SEMA5A ELISA Kit
ELA-E1512h 96 Tests
EUR 824
SEMA5A ELISA KIT|Human
EF005912 96 Tests
EUR 689
SEMA5A ELISA Kit (Human) (OKAN06624)
OKAN06624 96 Wells
EUR 792
Description: Description of target: This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.31 ng/mL
SEMA5A ELISA Kit (Human) (OKCD09337)
OKCD09337 96 Wells
EUR 909
Description: Description of target: This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.31ng/mL
SEMA5A ELISA Kit (Human) (OKEH04208)
OKEH04208 96 Wells
EUR 662
Description: Description of target: This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL
Polyclonal Semaphorin 5A Antibody (internal region)
APR13261G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Semaphorin 5A (internal region). This antibody is tested and proven to work in the following applications:
Pig IgA ELISA Kit
E-5A 1 x 96 well plate
EUR 461
SEMA5A ELISA Kit (Mouse) (OKEH05427)
OKEH05427 96 Wells
EUR 662
Description: Description of target: Bifunctional axonal guidance cue regulated by sulfated proteoglycans; attractive effects result from interactions with heparan sulfate proteoglycans (HSPGs), while the inhibitory effects depend on interactions with chondroitin sulfate proteoglycans (CSPGs). Ligand for receptor PLXNB3. In glioma cells, SEMA5A stimulation of PLXNB3 results in the disassembly of F-actin stress fibers, disruption of focal adhesions and cellular collapse as well as inhibition of cell migration and invasion through ARHGDIA-mediated inactivation of RAC1. May promote angiogenesis by increasing endothelial cell proliferation and migration and inhibiting apoptosis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL
SEMA5A Antibody
1-CSB-PA613413LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEMA5A. Recognizes SEMA5A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500
SEMA5A siRNA
20-abx932853
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SEMA5A siRNA
20-abx932854
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Human Semaphorin 7A ELISA kit
E01S0083-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 7A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Semaphorin 7A ELISA kit
E01S0083-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 7A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Semaphorin 7A ELISA kit
E01S0083-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 7A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Semaphorin 3 ELISA kit
E01S0084-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Semaphorin 3 ELISA kit
E01S0084-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Semaphorin 3 ELISA kit
E01S0084-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Semaphorin 4D ELISA kit
E01S0300-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Semaphorin 4D in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Semaphorin 4D ELISA kit
E01S0300-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Semaphorin 4D in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Semaphorin 4D ELISA kit
E01S0300-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Semaphorin 4D in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Semaphorin 6D ELISA kit
E01S0464-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Semaphorin 6D in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Semaphorin 6D ELISA kit
E01S0464-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Semaphorin 6D in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Semaphorin 6D ELISA kit
E01S0464-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Semaphorin 6D in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human semaphorin 3G ELISA kit
E01S0470-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human semaphorin 3G in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human semaphorin 3G ELISA kit
E01S0470-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human semaphorin 3G in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human semaphorin 3G ELISA kit
E01S0470-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human semaphorin 3G in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Semaphorin- 3C ELISA Kit
ELA-E2271h 96 Tests
EUR 824
Human Semaphorin- 3E ELISA Kit
ELA-E2272h 96 Tests
EUR 824
Human Semaphorin- 7A ELISA Kit
ELA-E2274h 96 Tests
EUR 824
Human Semaphorin- 6B ELISA Kit
ELA-E2276h 96 Tests
EUR 824
Human Semaphorin- 6C ELISA Kit
ELA-E2277h 96 Tests
EUR 824
Human SEMA5A shRNA Plasmid
20-abx955960
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SEMA5A Polyclonal Antibody
28714-100ul 100ul
EUR 252
SEMA5A Polyclonal Antibody
28714-50ul 50ul
EUR 187
M Sema5a Antibody
abx031644-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
M Sema5a Antibody
abx031644-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
M Sema5a Antibody
abx031645-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
M Sema5a Antibody
abx031645-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SEMA5A cloning plasmid
CSB-CL613413HU-10ug 10ug
EUR 1185
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3225
  • Sequence: ATGAAGGGAACCTGTGTTATAGCATGGCTGTTCTCAAGCCTGGGGCTGTGGAGACTCGCCCACCCAGAGGCCCAGGGTACGACTCAGTGCCAGAGAACCGAGCATCCAGTCATCTCCTATAAAGAAATTGGCCCCTGGTTACGGGAGTTCAGAGCGAAGAATGCTGTGGATTTCT
  • Show more
Description: A cloning plasmid for the SEMA5A gene.
SEMA5A Polyclonal Antibody
A64642 100 µg
EUR 570.55
Description: The best epigenetics products
SEMA5A Rabbit pAb
A14817-100ul 100 ul
EUR 308
SEMA5A Rabbit pAb
A14817-200ul 200 ul
EUR 459
SEMA5A Rabbit pAb
A14817-20ul 20 ul
EUR 183
SEMA5A Rabbit pAb
A14817-50ul 50 ul
EUR 223
Anti-SEMA5A antibody
STJ117017 100 µl
EUR 277
Description: This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.
Human Complement fragment 5a ELISA kit
E01C0663-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Complement fragment 5a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Complement fragment 5a ELISA kit
E01C0663-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Complement fragment 5a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Complement fragment 5a ELISA kit
E01C0663-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Complement fragment 5a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CES5A/ Carboxylesterase 5A ELISA Kit
E0476Hu 1 Kit
EUR 605
Human Carboxylesterase 5A (CES5A) ELISA Kit
abx251720-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human SEMA5A(Semaphorin 5A) ELISA Kit

Scroll to Top