Human SEMA5A(Semaphorin 5A) ELISA Kit
To Order Contact us: mario@youngresearch.eu
Human Semaphorin 5A (SEMA5A) ELISA Kit |
RDR-SEMA5A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Semaphorin 5A (SEMA5A)ELISA Kit |
201-12-1946 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 5A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 5A (SEMA5A) ELISA Kit |
20-abx153053 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Semaphorin 5A (SEMA5A) ELISA Kit |
abx251082-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human SEMA5A/ Semaphorin-5A ELISA Kit |
E2240Hu |
Sunlong |
1 Kit |
EUR 571 |
Human SEMA5A(Semaphorin-5A) ELISA Kit |
EH1776 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: Q13591
- Alias: SEMA5A/Semaphorin-5A/Semaphorin-F/Sema F/SEMAF/semaphorin F/SEMF/transmembrane domain(TM) and short cytoplasmic domain,(semaphorin) 5A
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Semaphorin 5A (SEMA5A) ELISA Kit |
abx573582-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Semaphorin 5A(SEMA5A)ELISA Kit |
GA-E1962HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 5A(SEMA5A)ELISA Kit |
GA-E1962HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 5A ELISA Kit (SEMA5A) |
RK02265 |
Abclonal |
96 Tests |
EUR 521 |
Human Semaphorin 5A (SEMA5A) ELISA Kit |
SEL924Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5A (SEMA5A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5A (SEMA5A) in tissue homogenates, cell lysates and other biological fluids. |
Human Semaphorin 5A (SEMA5A) ELISA Kit |
SEL924Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5A (SEMA5A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5A (SEMA5A) in tissue homogenates, cell lysates and other biological fluids. |
Human Semaphorin 5A (SEMA5A) ELISA Kit |
SEL924Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5A (SEMA5A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5A (SEMA5A) in tissue homogenates, cell lysates and other biological fluids. |
Human Semaphorin 5A (SEMA5A) ELISA Kit |
SEL924Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5A (SEMA5A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5A (SEMA5A) in tissue homogenates, cell lysates and other biological fluids. |
Human Semaphorin 5A (SEMA5A) ELISA Kit |
4-SEL924Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Semaphorin 5A elisa. Alternative names of the recognized antigen: SEMAF
- SemF
- Semaphorin-F
- Sema Domain, Immunoglobulin Domain(Ig), Transmembrane Domain(TM)and Short Cytoplasmic Domain 5A
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Semaphorin 5A (SEMA5A) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Semaphorin 5A (SEMA5A) Antibody |
20-abx178355 |
Abbexa |
|
|
|
Semaphorin 5A (SEMA5A) Antibody |
20-abx174506 |
Abbexa |
|
|
|
Semaphorin 5A (SEMA5A) Antibody |
abx031646-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Semaphorin 5A (SEMA5A) Antibody |
abx031646-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Semaphorin 5A (SEMA5A) Antibody |
abx431581-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Semaphorin 5A (SEMA5A) Antibody |
20-abx306749 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Semaphorin 5A (SEMA5A) ELISA Kit |
abx517654-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Semaphorin 5A (SEMA5A) Protein |
20-abx655031 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Semaphorin 5A (SEMA5A) CLIA Kit |
20-abx495991 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human SEMA5A (Semaphorin 5A) |
ELK6672 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Semaphorin 5A (SEMA5A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Semaphorin
- Show more
|
Description: A sandwich ELISA kit for detection of Semaphorin 5A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Semaphorin-5A (SEMA5A) |
KTE62333-48T |
Abbkine |
48T |
EUR 332 |
- SEMA5A belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Semaphorin-5A (SEMA5A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Semaphorin-5A (SEMA5A) |
KTE62333-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SEMA5A belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Semaphorin-5A (SEMA5A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Semaphorin-5A (SEMA5A) |
KTE62333-96T |
Abbkine |
96T |
EUR 539 |
- SEMA5A belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Semaphorin-5A (SEMA5A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Semaphorin 5A (SEMA5A) Antibody (HRP) |
20-abx306750 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Semaphorin 5A (SEMA5A) Antibody (FITC) |
20-abx306751 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Semaphorin 5A (SEMA5A) Antibody (Biotin) |
20-abx306752 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Human Semaphorin-5A/SEMA5A (C-6His) |
C499-10ug |
Novoprotein |
10ug |
EUR 156 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 0.1mM EDTA, 0.05% Tween 20, pH 7.2. |
Recombinant Human Semaphorin-5A/SEMA5A (C-6His) |
C499-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 0.1mM EDTA, 0.05% Tween 20, pH 7.2. |
Recombinant Human Semaphorin-5A/SEMA5A (C-6His) |
C499-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 0.1mM EDTA, 0.05% Tween 20, pH 7.2. |
Recombinant Human Semaphorin-5A/SEMA5A (C-6His) |
C499-50ug |
Novoprotein |
50ug |
EUR 369 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 0.1mM EDTA, 0.05% Tween 20, pH 7.2. |
Semaphorin 5A |
GT41026 |
Neuromics |
100 ug |
EUR 474 |
Semaphorin 5A |
P41026 |
Neuromics |
100 ug Blocking Peptide |
EUR 239 |
Recombinant Human Semaphorin-5A Protein |
RP01093 |
Abclonal |
10 μg |
EUR 190 |
Polyclonal Semaphorin 5A Antibody |
APR13260G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Semaphorin 5A . This antibody is tested and proven to work in the following applications: |
anti-Anti-Semaphorin 5A |
YF-PA25252 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Anti-Semaphorin 5A |
SEMA5A ELISA Kit (Human) (OKAN06624) |
OKAN06624 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.31 ng/mL |
SEMA5A ELISA Kit (Human) (OKCD09337) |
OKCD09337 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.31ng/mL |
SEMA5A ELISA Kit (Human) (OKEH04208) |
OKEH04208 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL |
Polyclonal Semaphorin 5A Antibody (internal region) |
APR13261G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Semaphorin 5A (internal region). This antibody is tested and proven to work in the following applications: |
SEMA5A ELISA Kit (Mouse) (OKEH05427) |
OKEH05427 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Bifunctional axonal guidance cue regulated by sulfated proteoglycans; attractive effects result from interactions with heparan sulfate proteoglycans (HSPGs), while the inhibitory effects depend on interactions with chondroitin sulfate proteoglycans (CSPGs). Ligand for receptor PLXNB3. In glioma cells, SEMA5A stimulation of PLXNB3 results in the disassembly of F-actin stress fibers, disruption of focal adhesions and cellular collapse as well as inhibition of cell migration and invasion through ARHGDIA-mediated inactivation of RAC1. May promote angiogenesis by increasing endothelial cell proliferation and migration and inhibiting apoptosis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
SEMA5A Antibody |
1-CSB-PA613413LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SEMA5A. Recognizes SEMA5A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500 |
SEMA5A siRNA |
20-abx932853 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SEMA5A siRNA |
20-abx932854 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Semaphorin 7A ELISA kit |
E01S0083-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 7A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 7A ELISA kit |
E01S0083-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 7A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 7A ELISA kit |
E01S0083-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 7A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3
ELISA kit |
E01S0084-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3
in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3
ELISA kit |
E01S0084-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3
in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3
ELISA kit |
E01S0084-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3
in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 4D ELISA kit |
E01S0300-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Semaphorin 4D in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 4D ELISA kit |
E01S0300-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Semaphorin 4D in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 4D ELISA kit |
E01S0300-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Semaphorin 4D in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 6D ELISA kit |
E01S0464-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Semaphorin 6D in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 6D ELISA kit |
E01S0464-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Semaphorin 6D in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 6D ELISA kit |
E01S0464-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Semaphorin 6D in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human semaphorin 3G ELISA kit |
E01S0470-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human semaphorin 3G in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human semaphorin 3G ELISA kit |
E01S0470-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human semaphorin 3G in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human semaphorin 3G ELISA kit |
E01S0470-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human semaphorin 3G in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human SEMA5A shRNA Plasmid |
20-abx955960 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SEMA5A Polyclonal Antibody |
28714-100ul |
SAB |
100ul |
EUR 252 |
SEMA5A Polyclonal Antibody |
28714-50ul |
SAB |
50ul |
EUR 187 |
M Sema5a Antibody |
abx031644-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
M Sema5a Antibody |
abx031644-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
M Sema5a Antibody |
abx031645-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
M Sema5a Antibody |
abx031645-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
SEMA5A cloning plasmid |
CSB-CL613413HU-10ug |
Cusabio |
10ug |
EUR 1185 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3225
- Sequence: ATGAAGGGAACCTGTGTTATAGCATGGCTGTTCTCAAGCCTGGGGCTGTGGAGACTCGCCCACCCAGAGGCCCAGGGTACGACTCAGTGCCAGAGAACCGAGCATCCAGTCATCTCCTATAAAGAAATTGGCCCCTGGTTACGGGAGTTCAGAGCGAAGAATGCTGTGGATTTCT
- Show more
|
Description: A cloning plasmid for the SEMA5A gene. |
SEMA5A Polyclonal Antibody |
A64642 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
SEMA5A Rabbit pAb |
A14817-100ul |
Abclonal |
100 ul |
EUR 308 |
SEMA5A Rabbit pAb |
A14817-200ul |
Abclonal |
200 ul |
EUR 459 |
SEMA5A Rabbit pAb |
A14817-20ul |
Abclonal |
20 ul |
EUR 183 |
SEMA5A Rabbit pAb |
A14817-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-SEMA5A antibody |
STJ117017 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene. |
Human Complement fragment 5a ELISA kit |
E01C0663-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Complement fragment 5a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Complement fragment 5a ELISA kit |
E01C0663-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Complement fragment 5a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Complement fragment 5a ELISA kit |
E01C0663-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Complement fragment 5a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CES5A/ Carboxylesterase 5A ELISA Kit |
E0476Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Carboxylesterase 5A (CES5A) ELISA Kit |
abx251720-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human CES5A(Carboxylesterase 5A) ELISA Kit |
EH2362 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q6NT32
- Alias: CES5A/CES7/Cauxin/Carboxylesterase-like urinary excreted protein homolog
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
ELISA kit for Human Carboxylesterase 5A |
EK4756 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Carboxylesterase 5A in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human Semaphorin 4B (SEMA4B)ELISA Kit |
201-12-0563 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 4B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 6C (SEMA6C)ELISA Kit |
201-12-0750 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 6C ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 6A (SEMA6A)ELISA Kit |
201-12-1088 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 6A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 6B (SEMA6B)ELISA Kit |
201-12-1326 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 6B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 3D (SEMA3D)ELISA Kit |
201-12-1513 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 3D ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 4C (SEMA4C)ELISA Kit |
201-12-1535 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 4C ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 3E (SEMA3E)ELISA Kit |
201-12-1563 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 3E ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 4F (SEMA4F)ELISA Kit |
201-12-1566 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 4F ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 4D (SEMA4D)ELISA Kit |
201-12-1567 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 4D ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 3F (SEMA3F)ELISA Kit |
201-12-1647 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 3F ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 4G (SEMA4G)ELISA Kit |
201-12-1722 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 4G ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 3C (SEMA3C)ELISA Kit |
201-12-1950 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 3C ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 4A (SEMA4A)ELISA Kit |
201-12-2063 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 4A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 3A (SEMA3A)ELISA Kit |
201-12-2079 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 3A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 3B (SEMA3B)ELISA Kit |
201-12-2090 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 3B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 5B (SEMA5B)ELISA Kit |
201-12-2276 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 5B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 3G (SEMA3G)ELISA Kit |
201-12-2391 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 3G ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 6D (SEMA6D)ELISA Kit |
201-12-2538 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 6D ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 7A (SEMA7A)ELISA Kit |
201-12-2539 |
SunredBio |
96 tests |
EUR 440 |
- This Semaphorin 7A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Semaphorin 3A (SEMA3A) ELISA Kit |
DLR-SEMA3A-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Semaphorin 3A (SEMA3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 3A (SEMA3A) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Semaphorin 3A (SEMA3A) ELISA Kit |
DLR-SEMA3A-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Semaphorin 3A (SEMA3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 3A (SEMA3A) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Semaphorin 3B (SEMA3B) ELISA Kit |
DLR-SEMA3B-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Semaphorin 3B (SEMA3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 3B (SEMA3B) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Semaphorin 3B (SEMA3B) ELISA Kit |
DLR-SEMA3B-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Semaphorin 3B (SEMA3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 3B (SEMA3B) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Semaphorin 3C (SEMA3C) ELISA Kit |
DLR-SEMA3C-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Semaphorin 3C (SEMA3C) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 3C (SEMA3C) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Semaphorin 3C (SEMA3C) ELISA Kit |
DLR-SEMA3C-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Semaphorin 3C (SEMA3C) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 3C (SEMA3C) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Semaphorin 3E (SEMA3E) ELISA Kit |
DLR-SEMA3E-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Semaphorin 3E (SEMA3E) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 3E (SEMA3E) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Semaphorin 3E (SEMA3E) ELISA Kit |
DLR-SEMA3E-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Semaphorin 3E (SEMA3E) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 3E (SEMA3E) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Semaphorin 3F (SEMA3F) ELISA Kit |
DLR-SEMA3F-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Semaphorin 3F (SEMA3F) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 3F (SEMA3F) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Semaphorin 3F (SEMA3F) ELISA Kit |
DLR-SEMA3F-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Semaphorin 3F (SEMA3F) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 3F (SEMA3F) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Semaphorin 4A (SEMA4A) ELISA Kit |
DLR-SEMA4A-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Semaphorin 4A (SEMA4A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 4A (SEMA4A) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Semaphorin 4A (SEMA4A) ELISA Kit |
DLR-SEMA4A-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Semaphorin 4A (SEMA4A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 4A (SEMA4A) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Semaphorin 4B (SEMA4B) ELISA Kit |
DLR-SEMA4B-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Semaphorin 4B (SEMA4B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 4B (SEMA4B) in samples from tissue homogenates or other biological fluids. |
Human Semaphorin 4B (SEMA4B) ELISA Kit |
DLR-SEMA4B-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Semaphorin 4B (SEMA4B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 4B (SEMA4B) in samples from tissue homogenates or other biological fluids. |
Human Semaphorin 4D (SEMA4D) ELISA Kit |
DLR-SEMA4D-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Semaphorin 4D (SEMA4D) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 4D (SEMA4D) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Semaphorin 4D (SEMA4D) ELISA Kit |
DLR-SEMA4D-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Semaphorin 4D (SEMA4D) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 4D (SEMA4D) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Semaphorin 7A (SEMA7A) ELISA Kit |
DLR-SEMA7A-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Semaphorin 7A (SEMA7A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 7A (SEMA7A) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Semaphorin 7A (SEMA7A) ELISA Kit |
DLR-SEMA7A-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Semaphorin 7A (SEMA7A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 7A (SEMA7A) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Semaphorin-3D(SEMA3D) ELISA kit |
CSB-EL020983HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Semaphorin-3D (SEMA3D) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Semaphorin-3D(SEMA3D) ELISA kit |
1-CSB-EL020983HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Semaphorin-3D(SEMA3D) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Semaphorin-3E(SEMA3E) ELISA kit |
CSB-EL020984HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Semaphorin-3E (SEMA3E) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Semaphorin-3E(SEMA3E) ELISA kit |
1-CSB-EL020984HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Semaphorin-3E(SEMA3E) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Semaphorin-3G(SEMA3G) ELISA kit |
CSB-EL020986HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Semaphorin-3G (SEMA3G) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Semaphorin-3G(SEMA3G) ELISA kit |
1-CSB-EL020986HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Semaphorin-3G(SEMA3G) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Semaphorin-4A(SEMA4A) ELISA kit |
CSB-EL020987HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Semaphorin-4A (SEMA4A) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Semaphorin-4A(SEMA4A) ELISA kit |
1-CSB-EL020987HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Semaphorin-4A(SEMA4A) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Semaphorin-7A(SEMA7A) ELISA kit |
CSB-EL021000HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Semaphorin-7A (SEMA7A) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Semaphorin-7A(SEMA7A) ELISA kit |
1-CSB-EL021000HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Semaphorin-7A(SEMA7A) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Semaphorin 3A(SEMA3A) ELISA kit |
E01S0355-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3A(SEMA3A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3A(SEMA3A) ELISA kit |
E01S0355-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3A(SEMA3A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3A(SEMA3A) ELISA kit |
E01S0355-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3A(SEMA3A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3C(SEMA3C) ELISA kit |
E01S0356-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3C(SEMA3C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3C(SEMA3C) ELISA kit |
E01S0356-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3C(SEMA3C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3C(SEMA3C) ELISA kit |
E01S0356-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3C(SEMA3C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3D(SEMA3D) ELISA kit |
E01S0357-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3D(SEMA3D) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3D(SEMA3D) ELISA kit |
E01S0357-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3D(SEMA3D) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3D(SEMA3D) ELISA kit |
E01S0357-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3D(SEMA3D) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3E(SEMA3E) ELISA kit |
E01S0358-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3E(SEMA3E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3E(SEMA3E) ELISA kit |
E01S0358-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3E(SEMA3E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3E(SEMA3E) ELISA kit |
E01S0358-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Semaphorin 3E(SEMA3E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Semaphorin 3A (SEMA3A) ELISA Kit |
abx055409-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Semaphorin 3A (SEMA3A) ELISA Kit |
20-abx153045 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Semaphorin 3B (SEMA3B) ELISA Kit |
20-abx153046 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Semaphorin 3C (SEMA3C) ELISA Kit |
20-abx153047 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Semaphorin 3E (SEMA3E) ELISA Kit |
20-abx153048 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Semaphorin 3F (SEMA3F) ELISA Kit |
20-abx153049 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Semaphorin 4A (SEMA4A) ELISA Kit |
20-abx153050 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Semaphorin 4B (SEMA4B) ELISA Kit |
20-abx153051 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Semaphorin 4D (SEMA4D) ELISA Kit |
20-abx153052 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Semaphorin 7A (SEMA7A) ELISA Kit |
20-abx153054 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Semaphorin 3G (SEMA3G) ELISA Kit |
abx251489-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Semaphorin 3A (SEMA3A) ELISA Kit |
abx251534-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Semaphorin 3B (SEMA3B) ELISA Kit |
abx251535-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Semaphorin 3F (SEMA3F) ELISA Kit |
abx251536-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Semaphorin 4D (SEMA4D) ELISA Kit |
abx251537-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Semaphorin 7A (SEMA7A) ELISA Kit |
abx253156-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human SEMA3A(Semaphorin-3A) ELISA Kit |
EH2193 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q14563
- Alias: SEMA3A/Sema3A/(semaphorin) 3A/coll-1/collapsin 1/Hsema-I/Hsema-III/sema domain, immunoglobulin domain(Ig), short basic domain, secreted/Sema III/SEMA1/SEMAD/SEMAIII/SEMAL/semaphorin D/Semaphor
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human SEMA3B(Semaphorin-3B) ELISA Kit |
EH2194 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 1.563-100 ng/ml
- Uniprot ID: Q13214
- Alias: SEMA3B/LUCA-1/SEMA3B/SEMA5/SEMAA/SEMAV/semaphorin 3B/LUCA-1/SemA/Sema A(V)/sema domain, immunoglobulin domain(Ig), short basic domain, secreted/Sema V/sema5/SEMA5/SEMAA/semaphorin A/semaphori
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml |
Human SEMA3F(Semaphorin-3F) ELISA Kit |
EH2195 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q13275
- Alias: SEMA3F/Sema III/F/Semaphorin IV(Sema IV)/Sema3F/SEMA4/SEMAK/sema domain, immunoglobulin domain(Ig), short basic domain, secreted,(semaphorin) 3F/sema domain, immunoglobulin domain(Ig), short b
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human SEMA4D(Semaphorin-4D) ELISA Kit |
EH2196 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 1.56-100 ng/ml
- Uniprot ID: Q92854
- Alias: SEMA4D/GR3/A8/BB18/CD100/COLL-4/M-sema-G/SEMA4D/SEMAJ/A8/CD100 antigen/CD100M-sema-G/coll-4/immunoglobulin domain(Ig), transmembrane domain(TM) and shortcytoplasmic domain, 4D/sema domain, imm
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml |
Human SEMA7A(Semaphorin 7A) ELISA Kit |
EH3766 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: O75326
- Alias: SEMA7A/CD108/H-Sema-L/Sema7A/SEMAL/CD108 antigen/CD108MGC126696/CDW108/CDw108/H-SEMA-K1/H-Sema-L/JMH/JMH blood group antigen/John-Milton-Hargen human blood group Ag/sema domain, immunoglobulin
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
ELISA kit for Human Semaphorin-3G |
EK4373 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Semaphorin-3G in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Semaphorin-3A |
EK4464 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Semaphorin-3A in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Semaphorin-3B |
EK4465 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Semaphorin-3B in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Semaphorin-3F |
EK4466 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Semaphorin-3F in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Semaphorin-4D |
EK4468 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Semaphorin-4D in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human SEMA3A/ Semaphorin-3A ELISA Kit |
E2234Hu |
Sunlong |
1 Kit |
EUR 571 |
Human SEMA3B/ Semaphorin-3B ELISA Kit |
E2235Hu |
Sunlong |
1 Kit |
EUR 571 |
Human SEMA3E/ Semaphorin-3E ELISA Kit |
E2236Hu |
Sunlong |
1 Kit |
EUR 537 |
Human SEMA3F/ Semaphorin-3F ELISA Kit |
E2237Hu |
Sunlong |
1 Kit |
EUR 571 |
Human SEMA3G/ Semaphorin-3G ELISA Kit |
E2238Hu |
Sunlong |
1 Kit |
EUR 571 |
Human SEMA4D/ Semaphorin-4D ELISA Kit |
E2239Hu |
Sunlong |
1 Kit |
EUR 571 |
Human SEMA6B/ Semaphorin-6B ELISA Kit |
E2241Hu |
Sunlong |
1 Kit |
EUR 571 |
Human SEMA3G(Semaphorin-3G) ELISA Kit |
EH2152 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: Q9NS98
- Alias: SEMA3G/sem2/Semaphorin sem2
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Semaphorin 4C (SEMA4C) ELISA Kit |
abx354487-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Semaphorin 3D (SEMA3D) ELISA Kit |
abx383099-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Semaphorin 4F (SEMA4F) ELISA Kit |
abx383102-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Semaphorin 3E (SEMA3E) ELISA Kit |
abx572689-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Semaphorin 3A (SEMA3A) ELISA Kit |
abx573922-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Semaphorin 4D (SEMA4D) ELISA Kit |
abx573953-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Semaphorin 3B (SEMA3B) ELISA Kit |
abx573961-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Semaphorin 5B (SEMA5B) ELISA Kit |
20-abx585184 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Semaphorin 3A (SEMA3A) ELISA Kit |
20-abx585411 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Semaphorin 3C (SEMA3C) ELISA Kit |
abx575627-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Semaphorin 3F (SEMA3F) ELISA Kit |
abx575807-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Semaphorin 6B (SEMA6B) ELISA Kit |
abx519949-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Semaphorin 6C (SEMA6C) ELISA Kit |
abx519952-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Semaphorin 3D(SEMA3D)ELISA Kit |
GA-E1529HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 3D(SEMA3D)ELISA Kit |
GA-E1529HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 4C(SEMA4C)ELISA Kit |
GA-E1551HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 4C(SEMA4C)ELISA Kit |
GA-E1551HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 3E(SEMA3E)ELISA Kit |
GA-E1579HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 3E(SEMA3E)ELISA Kit |
GA-E1579HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 4F(SEMA4F)ELISA Kit |
GA-E1582HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 4F(SEMA4F)ELISA Kit |
GA-E1582HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 4D(SEMA4D)ELISA Kit |
GA-E1583HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 4D(SEMA4D)ELISA Kit |
GA-E1583HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 3F(SEMA3F)ELISA Kit |
GA-E1663HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 3F(SEMA3F)ELISA Kit |
GA-E1663HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 4G(SEMA4G)ELISA Kit |
GA-E1738HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 4G(SEMA4G)ELISA Kit |
GA-E1738HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 3C(SEMA3C)ELISA Kit |
GA-E1966HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 3C(SEMA3C)ELISA Kit |
GA-E1966HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 4B(SEMA4B)ELISA Kit |
GA-E0579HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 4B(SEMA4B)ELISA Kit |
GA-E0579HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 6C(SEMA6C)ELISA Kit |
GA-E0766HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 6C(SEMA6C)ELISA Kit |
GA-E0766HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 6A(SEMA6A)ELISA Kit |
GA-E1104HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 6A(SEMA6A)ELISA Kit |
GA-E1104HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 6B(SEMA6B)ELISA Kit |
GA-E1342HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Semaphorin 6B(SEMA6B)ELISA Kit |
GA-E1342HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Semaphorin 3B ELISA Kit (SEMA3B) |
RK02259 |
Abclonal |
96 Tests |
EUR 521 |
Human SEMA5A(Semaphorin 5A) ELISA Kit