Human MARCKSL1(MARCKS Related Protein) ELISA Kit
To Order Contact us: mario@youngresearch.eu
Human MARCKS Related Protein (MARCKSL1) ELISA Kit |
RD-MARCKSL1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human MARCKS Related Protein (MARCKSL1) ELISA Kit |
RD-MARCKSL1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human MARCKS-related protein (MARCKSL1) |
1-CSB-EP013494HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 46.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human MARCKS-related protein(MARCKSL1) expressed in E.coli |
Human MARCKS Related Protein (MARCKSL1) ELISA Kit |
20-abx152274 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human MARCKS- related protein, MARCKSL1 ELISA KIT |
ELI-38545h |
Lifescience Market |
96 Tests |
EUR 824 |
Human MARCKS Related Protein ELISA Kit (MARCKSL1) |
RK01818 |
Abclonal |
96 Tests |
EUR 521 |
Human MARCKS Related Protein (MARCKSL1) ELISA Kit |
SEL709Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MARCKS Related Protein (MARCKSL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MARCKS Related Protein (MARCKSL1) in tissue homogenates, cell lysates and other biological fluids. |
Human MARCKS Related Protein (MARCKSL1) ELISA Kit |
SEL709Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MARCKS Related Protein (MARCKSL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MARCKS Related Protein (MARCKSL1) in tissue homogenates, cell lysates and other biological fluids. |
Human MARCKS Related Protein (MARCKSL1) ELISA Kit |
SEL709Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MARCKS Related Protein (MARCKSL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MARCKS Related Protein (MARCKSL1) in tissue homogenates, cell lysates and other biological fluids. |
Human MARCKS Related Protein (MARCKSL1) ELISA Kit |
SEL709Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MARCKS Related Protein (MARCKSL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MARCKS Related Protein (MARCKSL1) in tissue homogenates, cell lysates and other biological fluids. |
Human MARCKS Related Protein (MARCKSL1) ELISA Kit |
4-SEL709Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as MARCKS Related Protein elisa. Alternative names of the recognized antigen: MLP1
- MRP
- MLP
- F52
- MACMARCKS
- MARCKS-like protein 1
- Macrophage myristoylated alanine-rich C kinase substrate
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human MARCKS Related Protein (MARCKSL1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human MARCKS Related Protein (MARCKSL1) Protein |
20-abx652263 |
Abbexa |
-
EUR 746.00
-
EUR 300.00
-
EUR 2332.00
-
EUR 885.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
MARCKS Related Protein (MARCKSL1) Antibody |
20-abx177456 |
Abbexa |
|
|
|
MARCKS Related Protein (MARCKSL1) Antibody |
20-abx113613 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MARCKS Related Protein (MARCKSL1) Antibody |
20-abx173464 |
Abbexa |
|
|
|
Recombinant MARCKS Related Protein (MARCKSL1) |
4-RPL709Hu01 |
Cloud-Clone |
-
EUR 535.46
-
EUR 246.00
-
EUR 1732.96
-
EUR 644.32
-
EUR 1188.64
-
EUR 421.00
-
EUR 4182.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P49006
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 45.8kDa
- Isoelectric Point: 4.7
|
Description: Recombinant Human MARCKS Related Protein expressed in: E.coli |
Mouse MARCKS- related protein, Marcksl1 ELISA KIT |
ELI-19405m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine MARCKS- related protein, MARCKSL1 ELISA KIT |
ELI-42888b |
Lifescience Market |
96 Tests |
EUR 928 |
Rabbit MARCKS- related protein, MARCKSL1 ELISA KIT |
ELI-38779Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Human MARCKS Related Protein (MARCKSL1) CLIA Kit |
20-abx495961 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human MARCKSL1 (MARCKS Related Protein) |
ELK6502 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to MARCKS Related Protein (MARCKSL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of MARCKS Related Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human MARCKS-related protein (MARCKSL1) |
KTE62234-48T |
Abbkine |
48T |
EUR 332 |
- The myristoylated, alanine-rich protein MARCKS is a widely expressed, prominent substrate for protein kinase C, a key enzyme of intracellular signal transduction. The predicted 200-amino acid protein, which they called F52, shares 52% amino acid iden
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human MARCKS-related protein (MARCKSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human MARCKS-related protein (MARCKSL1) |
KTE62234-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The myristoylated, alanine-rich protein MARCKS is a widely expressed, prominent substrate for protein kinase C, a key enzyme of intracellular signal transduction. The predicted 200-amino acid protein, which they called F52, shares 52% amino acid iden
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human MARCKS-related protein (MARCKSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human MARCKS-related protein (MARCKSL1) |
KTE62234-96T |
Abbkine |
96T |
EUR 539 |
- The myristoylated, alanine-rich protein MARCKS is a widely expressed, prominent substrate for protein kinase C, a key enzyme of intracellular signal transduction. The predicted 200-amino acid protein, which they called F52, shares 52% amino acid iden
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human MARCKS-related protein (MARCKSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Marcksl1 ELISA Kit| Rat MARCKS-related protein ELISA Kit |
EF018939 |
Lifescience Market |
96 Tests |
EUR 689 |
Marcksl1 ELISA Kit| Mouse MARCKS-related protein ELISA Kit |
EF015454 |
Lifescience Market |
96 Tests |
EUR 689 |
MARCKSL1 ELISA Kit| Bovine MARCKS-related protein ELISA Kit |
EF011578 |
Lifescience Market |
96 Tests |
EUR 689 |
Rat MARCKS-Like Protein 1 (MARCKSL1) ELISA Kit |
abx391581-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse MARCKS-Like Protein 1 (MARCKSL1) ELISA Kit |
abx389819-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
MARCKSL1 MARCKS-Like 1 Human Recombinant Protein |
PROTP49006 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: MARCKSL1 Human Recombinant produced in E. coli is a single polypeptide chain containing 218 amino acids (1-195) and having a molecular mass of 21.9kDa. MARCKSL1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
MARCKS-Like Protein 1 (MARCKSL1) Antibody |
20-abx005386 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
MARCKS-Like Protein 1 (MARCKSL1) Antibody |
20-abx003768 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MARCKS-Like Protein 1 (MARCKSL1) Antibody |
abx029067-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
MARCKS-Like Protein 1 (MARCKSL1) Antibody |
abx029067-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
MARCKS-Like Protein 1 (MARCKSL1) Antibody |
20-abx320787 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MARCKS-Like Protein 1 (Marcksl1) Antibody |
abx235008-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
MARCKS-Like Protein 1 (Marcksl1) Antibody |
abx235009-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
MARCKS-Like Protein 1 (MARCKSL1) Antibody |
abx235010-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
MARCKS-Like Protein 1 (MARCKSL1) Antibody |
abx235011-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit |
DLR-MARCKS-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit |
DLR-MARCKS-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit |
RDR-MARCKS-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit |
RDR-MARCKS-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit |
RD-MARCKS-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit |
RD-MARCKS-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
MARCKS-related protein Antibody |
20-abx216722 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MARCKS-related protein Antibody |
20-abx121170 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
MARCKS-related protein Blocking Peptide |
20-abx161170 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MARCKSL1 ELISA Kit (Human) (OKCD02057) |
OKCD02057 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Controls cell movement by regulating actin cytoskeleton homeostasis and filopodium and lamellipodium formation. When unphosphorylated, induces cell migration. When phosphorylated by MAPK8, induces actin bundles formation and stabilization, thereby reducing actin plasticity, hence restricting cell movement, including neuronal migration. May also affect cancer cell migration. May be involved in coupling the protein kinase C and calmodulin signal transduction systems.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.105 ng/mL |
Recombinant Human MARCKS-related protein Protein, GST, E.coli-100ug |
QP6346-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human MARCKS-related protein Protein, GST, E.coli-10ug |
QP6346-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human MARCKS-related protein Protein, GST, E.coli-1mg |
QP6346-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human MARCKS-related protein Protein, GST, E.coli-200ug |
QP6346-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human MARCKS-related protein Protein, GST, E.coli-500ug |
QP6346-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human MARCKS-related protein Protein, GST, E.coli-50ug |
QP6346-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
MARCKSL1 Recombinant Protein (Human) |
RP018835 |
ABM |
100 ug |
Ask for price |
MARCKSL1 Recombinant Protein (Human) |
RP018838 |
ABM |
100 ug |
Ask for price |
MARCKS ELISA Kit (Human) (OKCD01967) |
OKCD01967 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: MARCKS is the most prominent cellular substrate for protein kinase C. This protein binds calmodulin, actin, and synapsin. MARCKS is a filamentous (F) actin cross-linking protein. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL |
MARCKS ELISA Kit (Human) (OKCA02125) |
OKCA02125 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: MARCKS is the most prominent cellular substrate for protein kinase C. This protein binds calmodulin, actin, and synapsin. MARCKS is a filamentous (F) actin cross-linking protein. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL. |
MARCKS Cell ELISA Kit |
abx595367-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
MARCKS Recombinant Protein (Human) |
RP041242 |
ABM |
100 ug |
Ask for price |
Marcksl1 antibody |
70R-18414 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal Marcksl1 antibody |
MARCKSL1 Antibody |
1-CSB-PA013494DSR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MARCKSL1. Recognizes MARCKSL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MARCKSL1 Antibody |
1-CSB-PA013494GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MARCKSL1. Recognizes MARCKSL1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MARCKSL1 siRNA |
20-abx903161 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MARCKSL1 siRNA |
20-abx923569 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MARCKSL1 siRNA |
20-abx923570 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Marcks ELISA Kit (Rat) (OKCD01968) |
OKCD01968 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: MARCKS is the most prominent cellular substrate for protein kinase C. This protein binds calmodulin, actin, and synapsin. MARCKS is a filamentous (F) actin cross-linking protein. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.55 ng/mL |
MARCKS ELISA Kit (Mouse) (OKEH08184) |
OKEH08184 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.093ng/mL |
MARCKSL1 protein (His tag) |
80R-2746 |
Fitzgerald |
20 ug |
EUR 322 |
Description: Purified recombinant MARCKSL1 protein (His tag) |
MARCKSL1 Recombinant Protein (Mouse) |
RP149480 |
ABM |
100 ug |
Ask for price |
MARCKSL1 Recombinant Protein (Rat) |
RP210896 |
ABM |
100 ug |
Ask for price |
Human MARCKSL1 shRNA Plasmid |
20-abx962180 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
phospho-Marcks (phospho-Marcks) Antibody |
abx236404-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
phospho-Marcks (phospho-Marcks) Antibody |
abx236405-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
MARCKS Colorimetric Cell-Based ELISA Kit |
EKC1351 |
BosterBio |
100ul |
EUR 572 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
MARCKSL1 Polyclonal Antibody |
30833-100ul |
SAB |
100ul |
EUR 252 |
MARCKSL1 Polyclonal Antibody |
30833-50ul |
SAB |
50ul |
EUR 187 |
MARCKSL1 cloning plasmid |
CSB-CL013494HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 588
- Sequence: atgggcagccagagctccaaggctccccggggcgacgtgaccgccgaggaggcagcaggcgcttcccccgcgaaggccaacggccaggagaatggccacgtgaaaagcaatggagacttatcccccaagggtgaaggggagtcgccccctgtgaacggaacagatgaggcagccgg
- Show more
|
Description: A cloning plasmid for the MARCKSL1 gene. |
MARCKSL1 cloning plasmid |
CSB-CL013494HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 588
- Sequence: atgggcagccagagctccaaggctccccggggcgacgtgaccgccgaggaggcagcaggcgcttcccccgcgaaggccaacggccaggagaatggccacgtgaaaagcaatggagacttatcccccaagggtgaaggggagtcgccccctgtgaacggaacagatgaggcagccgg
- Show more
|
Description: A cloning plasmid for the MARCKSL1 gene. |
MARCKSL1 Rabbit pAb |
A7132-100ul |
Abclonal |
100 ul |
EUR 308 |
MARCKSL1 Rabbit pAb |
A7132-200ul |
Abclonal |
200 ul |
EUR 459 |
MARCKSL1 Rabbit pAb |
A7132-20ul |
Abclonal |
20 ul |
EUR 183 |
MARCKSL1 Rabbit pAb |
A7132-50ul |
Abclonal |
50 ul |
EUR 223 |
MARCKSL1 Rabbit pAb |
A4950-100ul |
Abclonal |
100 ul |
EUR 308 |
MARCKSL1 Rabbit pAb |
A4950-200ul |
Abclonal |
200 ul |
EUR 459 |
MARCKSL1 Rabbit pAb |
A4950-20ul |
Abclonal |
20 ul |
Ask for price |
MARCKSL1 Rabbit pAb |
A4950-50ul |
Abclonal |
50 ul |
Ask for price |
anti- Marcksl1 antibody |
FNab05008 |
FN Test |
100µg |
EUR 585 |
- Immunogen: MARCKS-like 1
- Uniprot ID: P49006
- Gene ID: 65108
- Research Area: Signal Transduction
|
Description: Antibody raised against Marcksl1 |
anti- Marcksl1 antibody |
FNab05009 |
FN Test |
100µg |
EUR 585 |
- Immunogen: MARCKS-like 1
- Uniprot ID: P49006
- Gene ID: 65108
- Research Area: Signal Transduction
|
Description: Antibody raised against Marcksl1 |
anti- MARCKSL1 antibody |
FNab05010 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: MARCKS-like 1
- Uniprot ID: P49006
- Research Area: Signal Transduction
|
Description: Antibody raised against MARCKSL1 |
anti- MARCKSL1 antibody |
FNab05011 |
FN Test |
100µg |
EUR 585 |
- Immunogen: MARCKS-like 1
- Uniprot ID: P49006
- Gene ID: 65108
- Research Area: Signal Transduction
|
Description: Antibody raised against MARCKSL1 |
Anti-MARCKSL1 antibody |
STJ24502 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the myristoylated alanine-rich C-kinase substrate (MARCKS) family. Members of this family play a role in cytoskeletal regulation, protein kinase C signaling and calmodulin signaling. The encoded protein affects the formation of adherens junction. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are located on the long arm of chromosomes 6 and 10. |
Anti-MARCKSL1 antibody |
STJ29212 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the myristoylated alanine-rich C-kinase substrate (MARCKS) family. Members of this family play a role in cytoskeletal regulation, protein kinase C signaling and calmodulin signaling. The encoded protein affects the formation of adherens junction. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are located on the long arm of chromosomes 6 and 10. |
MARCKS antibody |
20R-1688 |
Fitzgerald |
100 ul |
EUR 705 |
Description: Rabbit polyclonal MARCKS antibody |
MARCKS antibody |
20R-2097 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal MARCKS antibody |
MARCKS antibody |
20R-2120 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal MARCKS antibody |
MARCKS antibody |
20R-2164 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal MARCKS antibody |
MARCKS antibody |
20R-2415 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal MARCKS antibody |
MARCKS antibody |
20R-2440 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal MARCKS antibody |
MARCKS antibody |
20R-2858 |
Fitzgerald |
100 ul |
EUR 349 |
Description: Rabbit polyclonal MARCKS antibody |
Marcks antibody |
70R-18413 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal Marcks antibody |
MARCKS antibody |
70R-10037 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal MARCKS antibody |
MARCKS antibody |
70R-10038 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal MARCKS antibody |
MARCKS Antibody |
1-CSB-PA003190 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against MARCKS. Recognizes MARCKS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
MARCKS antibody |
70R-50020 |
Fitzgerald |
100 ul |
EUR 287 |
Description: Purified Polyclonal MARCKS antibody |
MARCKS antibody |
70R-50021 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal MARCKS antibody |
MARCKS antibody |
70R-34253 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal MARCKS antibody |
MARCKS antibody |
70R-34255 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal MARCKS antibody |
MARCKS Antibody |
AF5398 |
Affbiotech |
200ul |
EUR 304 |
Description: MARCKS Antibody detects endogenous levels of total MARCKS. |
MARCKS Antibody |
AF6250 |
Affbiotech |
200ul |
EUR 304 |
Description: MARCKS Antibody detects endogenous levels of total MARCKS. |
MARCKS Antibody |
1-CSB-PA013493GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Protein A Purified
|
Description: A polyclonal antibody against MARCKS. Recognizes MARCKS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
MARCKS Antibody |
1-CSB-PA009918 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against MARCKS. Recognizes MARCKS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000 |
MARCKS siRNA |
20-abx923571 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MARCKS siRNA |
20-abx923572 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MARCKS Antibody |
AF7789 |
Affbiotech |
200ul |
EUR 376 |
Description: MARCKS Antibody detects endogenous levels of MARCKS. |
MARCKS Antibody |
AF7790 |
Affbiotech |
200ul |
EUR 376 |
Description: MARCKS Antibody detects endogenous levels of MARCKS. |
anti-MARCKS |
YF-PA24108 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to MARCKS |
MARCKSL1 ORF Vector (Human) (pORF) |
ORF006279 |
ABM |
1.0 ug DNA |
EUR 95 |
MARCKSL1 ORF Vector (Human) (pORF) |
ORF006280 |
ABM |
1.0 ug DNA |
EUR 95 |
MARCKS-Like 1 Protein |
20-abx263347 |
Abbexa |
-
EUR 1609.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
MARCKS Protein (159-165) |
20-abx265892 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 286.00
|
|
- Shipped within 5-10 working days.
|
MARCKS Recombinant Protein (Mouse) |
RP149477 |
ABM |
100 ug |
Ask for price |
MARCKSL1 Protein Vector (Human) (pPB-C-His) |
PV025113 |
ABM |
500 ng |
EUR 329 |
MARCKSL1 Protein Vector (Human) (pPB-N-His) |
PV025114 |
ABM |
500 ng |
EUR 329 |
MARCKSL1 Protein Vector (Human) (pPM-C-HA) |
PV025115 |
ABM |
500 ng |
EUR 329 |
MARCKSL1 Protein Vector (Human) (pPM-C-His) |
PV025116 |
ABM |
500 ng |
EUR 329 |
MARCKSL1 Protein Vector (Human) (pPB-C-His) |
PV025117 |
ABM |
500 ng |
EUR 329 |
MARCKSL1 Protein Vector (Human) (pPB-N-His) |
PV025118 |
ABM |
500 ng |
EUR 329 |
MARCKSL1 Protein Vector (Human) (pPM-C-HA) |
PV025119 |
ABM |
500 ng |
EUR 329 |
MARCKSL1 Protein Vector (Human) (pPM-C-His) |
PV025120 |
ABM |
500 ng |
EUR 329 |
Human MARCKS shRNA Plasmid |
20-abx952766 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
MARCKS Colorimetric Cell-Based ELISA Kit (OKAG00856) |
OKAG00856 |
Aviva Systems Biology |
96 Wells |
EUR 596 |
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity: |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Human Myeloid related protein ELISA kit |
E01M0341-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Myeloid related protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Myeloid related protein ELISA kit |
E01M0341-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Myeloid related protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Myeloid related protein ELISA kit |
E01M0341-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Myeloid related protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Agouti Related Protein ELISA kit |
E01A0508-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Agouti Related Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Agouti Related Protein ELISA kit |
E01A0508-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Agouti Related Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Agouti Related Protein ELISA kit |
E01A0508-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Agouti Related Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Haptoglobin Related Protein ELISA kit |
E01H0103-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Haptoglobin Related Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Haptoglobin Related Protein ELISA kit |
E01H0103-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Haptoglobin Related Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Haptoglobin Related Protein ELISA kit |
E01H0103-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Haptoglobin Related Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit |
20-abx152273 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Myristoylated Alanine Rich Protein Kinase C Substrate(MARCKS)ELISA Kit |
QY-E01553 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit |
SEH688Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) in Tissue homogenates, cell lysates and other biological fluids. |
Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit |
SEH688Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) in Tissue homogenates, cell lysates and other biological fluids. |
Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit |
SEH688Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) in Tissue homogenates, cell lysates and other biological fluids. |
Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit |
SEH688Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) in Tissue homogenates, cell lysates and other biological fluids. |
Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit |
4-SEH688Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Myristoylated Alanine Rich Protein Kinase C Substrate elisa. Alternative names of the recognized antigen: 80K-L
- MACS
- MRACKS
- PKCSL
- PRKCSL
- Protein kinase C substrate, 80 kDa protein, light chain
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Rat MARCKSL1 shRNA Plasmid |
20-abx986597 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MARCKSL1 Polyclonal Conjugated Antibody |
C30833 |
SAB |
100ul |
EUR 397 |
Mouse MARCKSL1 shRNA Plasmid |
20-abx971525 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MARCKSL1 sgRNA CRISPR Lentivector set (Human) |
K1270601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Anti-MARCKS like protein (8C8) |
YF-MA11638 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MARCKS like protein |
Anti-MARCKS like protein (2H5) |
YF-MA19269 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MARCKS like protein |
MARCKS Polyclonal Antibody |
27245-100ul |
SAB |
100ul |
EUR 252 |
MARCKS Polyclonal Antibody |
27245-50ul |
SAB |
50ul |
EUR 187 |
Phospho-MARCKS antibody |
70R-11974 |
Fitzgerald |
100 ul |
EUR 525 |
Description: Rabbit polyclonal Phospho-MARCKS antibody |
MARCKS antibody (Ser152,156) |
70R-15008 |
Fitzgerald |
100 ul |
EUR 392 |
Description: Rabbit polyclonal MARCKS antibody (Ser152,156) |
MARCKS Rabbit pAb |
A0936-100ul |
Abclonal |
100 ul |
EUR 308 |
MARCKS Rabbit pAb |
A0936-200ul |
Abclonal |
200 ul |
EUR 459 |
MARCKS Rabbit pAb |
A0936-20ul |
Abclonal |
20 ul |
EUR 183 |
MARCKS Rabbit pAb |
A0936-50ul |
Abclonal |
50 ul |
EUR 223 |
MARCKS Blocking Peptide |
33R-2357 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MARCKS antibody, catalog no. 70R-10038 |
MARCKS Blocking Peptide |
33R-4233 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MARCKS antibody, catalog no. 70R-10037 |
Phospho-MARCKS Antibody |
3650-100 |
Biovision |
|
EUR 425 |
MARCKS antibody (Ser162) |
70R-37324 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Rabbit Polyclonal MARCKS antibody (Ser162) |
Human MARCKSL1(MARCKS Related Protein) ELISA Kit