Human PEPD(Peptidase D) ELISA Kit

Human PEPD(Peptidase D) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Human Peptidase D (PEPD) ELISA Kit
RDR-PEPD-Hu-48Tests 48 Tests
EUR 589
Human Peptidase D (PEPD) ELISA Kit
RDR-PEPD-Hu-96Tests 96 Tests
EUR 820
Human Peptidase D (PEPD) ELISA Kit
RD-PEPD-Hu-48Tests 48 Tests
EUR 563
Human Peptidase D (PEPD) ELISA Kit
RD-PEPD-Hu-96Tests 96 Tests
EUR 783
Human Peptidase D (PEPD) ELISA Kit
20-abx258121
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Peptidase D (PEPD) ELISA Kit
abx352384-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Peptidase D(PEPD)ELISA Kit
QY-E01316 96T
EUR 361
Human Peptidase D (PEPD) ELISA Kit
SEM011Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidase D (PEPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidase D (PEPD) in serum, plasma, tissue homogenates and other biological fluids.
Human Peptidase D (PEPD) ELISA Kit
SEM011Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidase D (PEPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidase D (PEPD) in serum, plasma, tissue homogenates and other biological fluids.
Human Peptidase D (PEPD) ELISA Kit
SEM011Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidase D (PEPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidase D (PEPD) in serum, plasma, tissue homogenates and other biological fluids.
Human Peptidase D (PEPD) ELISA Kit
SEM011Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidase D (PEPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidase D (PEPD) in serum, plasma, tissue homogenates and other biological fluids.
Human Peptidase D (PEPD) ELISA Kit
4-SEM011Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Peptidase D elisa. Alternative names of the recognized antigen: PRD
  • Xaa-Pro Dipeptidase
  • Prolidase
  • Imidodipeptidase
  • Proline dipeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Peptidase D (PEPD) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Peptidase D (PEPD) Antibody
20-abx004149
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peptidase D (PEPD) Antibody
abx036679-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Peptidase D (PEPD) Antibody
20-abx129281
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Peptidase D (PEPD) Antibody
20-abx173976
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Peptidase D (PEPD) Antibody
20-abx318754
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Peptidase D (PEPD) Antibody
abx236307-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Recombinant Peptidase D (PEPD)
4-RPM011Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P12955
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Peptidase D expressed in: E.coli
ELISA kit for Human PEPD (Peptidase D)
E-EL-H5575 1 plate of 96 wells
EUR 534
  • Gentaur's PEPD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PEPD. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PEPD (Peptidase D) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human PEPD (Peptidase D)
ELK6673 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Peptidase D (PEPD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Peptidase D (PE
  • Show more
Description: A sandwich ELISA kit for detection of Peptidase D from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Peptidase D (PEPD) CLIA Kit
20-abx496011
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Peptidase D (PEPD) Protein
20-abx167041
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Peptidase D (PEPD) Antibody (HRP)
20-abx315913
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Peptidase D (PEPD) Antibody (FITC)
20-abx315914
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Peptidase D (PEPD) Antibody (Biotin)
20-abx315915
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PEPD Peptidase D Human Recombinant Protein
PROTP12955 Regular: 20ug
EUR 317
Description: PEPD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 516 amino acids (1-493a.a.) and having a molecular mass of 56.9kDa.;PEPD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Peptidase D (PEPD) Polyclonal Antibody (Human)
4-PAM011Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD)
Peptidase D (PEPD) Polyclonal Antibody (Human), APC
4-PAM011Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with APC.
Peptidase D (PEPD) Polyclonal Antibody (Human), Biotinylated
4-PAM011Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with Biotin.
Peptidase D (PEPD) Polyclonal Antibody (Human), Cy3
4-PAM011Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with Cy3.
Peptidase D (PEPD) Polyclonal Antibody (Human), FITC
4-PAM011Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with FITC.
Peptidase D (PEPD) Polyclonal Antibody (Human), HRP
4-PAM011Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with HRP.
Peptidase D (PEPD) Polyclonal Antibody (Human), PE
4-PAM011Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with PE.
Peptidase D (PEPD) Polyclonal Antibody (Human), APC-Cy7
4-PAM011Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with APC-Cy7.
Human PEPD ELISA Kit
ELA-E9177h 96 Tests
EUR 824
PEPD ELISA KIT|Human
EF006487 96 Tests
EUR 689
Peptidase D antibody
70R-4294 50 ug
EUR 467
Description: Rabbit polyclonal Peptidase D antibody raised against the middle region of PEPD
Peptidase D Antibody
20-abx114368
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peptidase D Blocking Peptide
33R-4964 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PEPD antibody, catalog no. 70R-4294
Human Xaa-Pro dipeptidase (PEPD) ELISA Kit
abx251813-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Human PEPD(Xaa-Pro dipeptidase) ELISA Kit
EH2449 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: P12955
  • Alias: PEPD/Proline dipeptidase(Prolidase)/Imidodipeptidase/Peptidase D/PRD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml
Human PEPD/ Xaa-Pro dipeptidase ELISA Kit
E1906Hu 1 Kit
EUR 605
Human Xaa- Pro dipeptidase, PEPD ELISA KIT
ELI-07707h 96 Tests
EUR 824
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
PEPD antibody
70R-19212 50 ul
EUR 435
Description: Rabbit polyclonal PEPD antibody
PEPD Antibody
32842-100ul 100ul
EUR 252
PEPD antibody
10R-5236 100 ul
EUR 691
Description: Mouse monoclonal PEPD antibody
PEPD Antibody
43029-100ul 100ul
EUR 252
PEPD Antibody
DF7333 200ul
EUR 304
Description: PEPD Antibody detects endogenous levels of total PEPD.
PEPD Antibody
1-CSB-PA017784GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PEPD. Recognizes PEPD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
PEPD Antibody
1-CSB-PA017784LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEPD. Recognizes PEPD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
PEPD siRNA
20-abx903940
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PEPD siRNA
20-abx928247
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PEPD siRNA
20-abx928248
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PEPD Antibody
ABD7333 100 ug
EUR 438
anti-PEPD
YF-PA13713 50 ul
EUR 363
Description: Mouse polyclonal to PEPD
anti-PEPD
YF-PA13714 50 ug
EUR 363
Description: Mouse polyclonal to PEPD
anti-PEPD
YF-PA13715 100 ul
EUR 403
Description: Rabbit polyclonal to PEPD
anti-PEPD
YF-PA13716 100 ug
EUR 403
Description: Rabbit polyclonal to PEPD
anti-PEPD
YF-PA24341 50 ul
EUR 334
Description: Mouse polyclonal to PEPD
Human Xaa-Pro Dipeptidase/Prolidase(PEPD) ELISA Kit
CSB-E16196h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Xaa-Pro Dipeptidase/Prolidase(PEPD) ELISA Kit
1-CSB-E16196h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Xaa-Pro Dipeptidase/Prolidase(PEPD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human PEPD shRNA Plasmid
20-abx953458
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PEPD Recombinant Protein (Human)
RP023089 100 ug Ask for price
PEPD Recombinant Protein (Human)
RP023092 100 ug Ask for price
Mouse Xaa-Pro dipeptidase(PEPD) ELISA kit
CSB-EL017784MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Xaa-Pro dipeptidase (PEPD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Xaa-Pro dipeptidase(PEPD) ELISA kit
1-CSB-EL017784MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Xaa-Pro dipeptidase(PEPD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat Xaa-Pro dipeptidase (PEPD) ELISA Kit
abx256674-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Rat Pepd/ Xaa-Pro dipeptidase ELISA Kit
E0748Ra 1 Kit
EUR 646
Rat Xaa- Pro dipeptidase, Pepd ELISA KIT
ELI-07705r 96 Tests
EUR 886
Mouse Xaa- Pro dipeptidase, Pepd ELISA KIT
ELI-07706m 96 Tests
EUR 865
Mouse Xaa-Pro dipeptidase (PEPD) ELISA Kit
abx521027-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Rat Pepd(Xaa-Pro dipeptidase) ELISA Kit
ER0699 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q5I0D7
  • Alias: Pepd/Proline dipeptidase(Prolidase)/Imidodipeptidase/Peptidase D/PRD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml
Pepd ELISA Kit| Rat Xaa-Pro dipeptidase ELISA Kit
EF017512 96 Tests
EUR 689
Pepd ELISA Kit| Mouse Xaa-Pro dipeptidase ELISA Kit
EF015818 96 Tests
EUR 689
ELISA kit for Human Xaa-Pro Dipeptidase/Prolidase (PEPD)
KTE61249-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Xaa-Pro Dipeptidase/Prolidase (PEPD)
KTE61249-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Xaa-Pro Dipeptidase/Prolidase (PEPD)
KTE61249-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
PEPD Blocking Peptide
DF7333-BP 1mg
EUR 195
PEPD Conjugated Antibody
C43029 100ul
EUR 397
PEPD Conjugated Antibody
C32842 100ul
EUR 397
PEPD cloning plasmid
CSB-CL017784HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggcggcggccaccggaccctcgttttggctggggaatgaaaccctgaaggtgccgctggcgctctttgccttgaaccggcagcgcctgtgtgagcggctgcggaagaaccctgctgtgcaggccggctccatcgtggtcctgcagggcggggaggagactcagcgctactgca
  • Show more
Description: A cloning plasmid for the PEPD gene.
PEPD cloning plasmid
CSB-CL017784HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggcggcggccaccggaccctcgttttggctggggaatgaaaccctgaaggtgccgctggcgctctttgccttgaaccggcagcgcctgtgtgagcggctgcggaagaaccctgctgtgcaggccggctccatcgtggtcctgcagggcggggaggagactcagcgctactgca
  • Show more
Description: A cloning plasmid for the PEPD gene.
PEPD Rabbit pAb
A5416-100ul 100 ul
EUR 308
PEPD Rabbit pAb
A5416-200ul 200 ul
EUR 459
PEPD Rabbit pAb
A5416-20ul 20 ul
EUR 183
PEPD Rabbit pAb
A5416-50ul 50 ul
EUR 223
anti- PEPD antibody
FNab06307 100µg
EUR 585
  • Immunogen: peptidase D
  • Uniprot ID: P12955
  • Gene ID: 5184
  • Research Area: Metabolism
Description: Antibody raised against PEPD
Anti-PEPD antibody
PAab06307 100 ug
EUR 412
pCMV-SPORT6-PEPD
PVT13160 2 ug
EUR 391
Anti-PEPD antibody
STJ27369 100 µl
EUR 277
Description: This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.
Human Dipeptidyl Peptidase IV ELISA kit
E01D0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidyl Peptidase IV in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Dipeptidyl Peptidase IV ELISA kit
E01D0039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidyl Peptidase IV in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Dipeptidyl Peptidase IV ELISA kit
E01D0039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidyl Peptidase IV in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Procollagen C peptidase ELISA kit
E01P0624-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Procollagen C peptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Procollagen C peptidase ELISA kit
E01P0624-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Procollagen C peptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Procollagen C peptidase ELISA kit
E01P0624-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Procollagen C peptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Peptidase Inhibitor 3 ELISA kit
E01P0744-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Peptidase Inhibitor 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Peptidase Inhibitor 3 ELISA kit
E01P0744-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Peptidase Inhibitor 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Peptidase Inhibitor 3 ELISA kit
E01P0744-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Peptidase Inhibitor 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Dipeptidyl Peptidase 10 ELISA Kit
ELA-E12621h 96 Tests
EUR 824
Human LAP(Leucine Peptidase) ELISA Kit
EH0162 96T
EUR 524.1
  • Detection range: 0.781-50 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml
Human Kyphoscoliosis peptidase, KY ELISA KIT
ELI-46534h 96 Tests
EUR 824
Human Kyphoscoliosis Peptidase(KY)ELISA Kit
QY-E02929 96T
EUR 361
PEPD ORF Vector (Human) (pORF)
ORF007697 1.0 ug DNA
EUR 95
PEPD ORF Vector (Human) (pORF)
ORF007698 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
14,15-DHET Human Urine ELISA Kit
DH3 1 Kit
EUR 323
PEPD Antibody, HRP conjugated
1-CSB-PA017784LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEPD. Recognizes PEPD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PEPD Antibody, FITC conjugated
1-CSB-PA017784LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEPD. Recognizes PEPD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PEPD Antibody, Biotin conjugated
1-CSB-PA017784LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEPD. Recognizes PEPD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PEPD protein (His tag)
80R-4114 100 ug
EUR 327
Description: Recombinant Human PEPD protein (His tag)
Rat PEPD shRNA Plasmid
20-abx988584
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse PEPD shRNA Plasmid
20-abx971997
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
anti-PEPD (1D5-H3)
LF-MA10221 100 ug
EUR 363
Description: Mouse monoclonal to PEPD
pCMV-SPORT6-PEPD Plasmid
PVT16130 2 ug
EUR 325
PEPD Recombinant Protein (Mouse)
RP161330 100 ug Ask for price
PEPD Recombinant Protein (Rat)
RP220043 100 ug Ask for price
Anti-PEPD (4A5-D10)
YF-MA20384 100 ug
EUR 363
Description: Mouse monoclonal to PEPD
Human procollagen C peptidase,PCP ELISA Kit
201-12-0850 96 tests
EUR 440
  • This procollagen C peptidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Dipeptidyl-Peptidase 4,DPP4 ELISA Kit
201-12-2186 96 tests
EUR 440
  • This Dipeptidyl-Peptidase 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Tripeptidyl Peptidase I (TPP1)ELISA Kit
201-12-2521 96 tests
EUR 440
  • This Tripeptidyl Peptidase I ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
ELISA kit for Human DPP4 (Dipeptidyl Peptidase ?)
E-EL-H0058 1 plate of 96 wells
EUR 534
  • Gentaur's DPP4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DPP4. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DPP4 (Dipeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human DPP10 (Dipeptidyl Peptidase ?)
E-EL-H0358 1 plate of 96 wells
EUR 534
  • Gentaur's DPP10 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DPP10. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DPP10 (Dipeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human TPP1 (Tripeptidyl Peptidase ?)
E-EL-H1479 1 plate of 96 wells
EUR 534
  • Gentaur's TPP1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TPP1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TPP1 (Tripeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human DPP6 (Dipeptidyl Peptidase ?)
E-EL-H2390 1 plate of 96 wells
EUR 534
  • Gentaur's DPP6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DPP6. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DPP6 (Dipeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant
Human Peptidase Inhibitor 16 (PI16) ELISA Kit
DLR-PI16-Hu-48T 48T
EUR 554
  • Should the Human Peptidase Inhibitor 16 (PI16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peptidase Inhibitor 16 (PI16) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Peptidase Inhibitor 16 (PI16) ELISA Kit
DLR-PI16-Hu-96T 96T
EUR 725
  • Should the Human Peptidase Inhibitor 16 (PI16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peptidase Inhibitor 16 (PI16) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
DLR-TPP1-Hu-48T 48T
EUR 517
  • Should the Human Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
DLR-TPP1-Hu-96T 96T
EUR 673
  • Should the Human Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
DLR-TPP2-Hu-48T 48T
EUR 517
  • Should the Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Tripeptidyl-Peptidase 2 (TPP2) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
DLR-TPP2-Hu-96T 96T
EUR 673
  • Should the Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Tripeptidyl-Peptidase 2 (TPP2) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
DLR-DPP10-Hu-48T 48T
EUR 517
  • Should the Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 10 (DPP10) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
DLR-DPP10-Hu-96T 96T
EUR 673
  • Should the Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 10 (DPP10) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
DLR-DPP4-Hu-48T 48T
EUR 479
  • Should the Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase IV (DPP4) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
DLR-DPP4-Hu-96T 96T
EUR 621
  • Should the Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase IV (DPP4) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
DLR-DPP6-Hu-48T 48T
EUR 517
  • Should the Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 6 (DPP6) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
DLR-DPP6-Hu-96T 96T
EUR 673
  • Should the Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 6 (DPP6) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
DLR-DPP8-Hu-48T 48T
EUR 517
  • Should the Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 8 (DPP8) in samples from tissue homogenates or other biological fluids.
Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
DLR-DPP8-Hu-96T 96T
EUR 673
  • Should the Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 8 (DPP8) in samples from tissue homogenates or other biological fluids.
Human Tripeptidyl-peptidase 1(TPP1) ELISA kit
CSB-EL024113HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tripeptidyl-peptidase 1 (TPP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Tripeptidyl-peptidase 1(TPP1) ELISA kit
1-CSB-EL024113HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tripeptidyl-peptidase 1(TPP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Peptidase inhibitor 16(PI16) ELISA kit
CSB-EL017951HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Peptidase inhibitor 16 (PI16) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Peptidase inhibitor 16(PI16) ELISA kit
1-CSB-EL017951HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Peptidase inhibitor 16(PI16) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human CTSC/ Dipeptidyl peptidase 1 ELISA Kit
E0597Hu 1 Kit
EUR 571
Human Serine peptidase inhibitors K1 ELISA kit
E01S0027-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Serine peptidase inhibitors K1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Serine peptidase inhibitors K1 ELISA kit
E01S0027-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Serine peptidase inhibitors K1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Serine peptidase inhibitors K1 ELISA kit
E01S0027-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Serine peptidase inhibitors K1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Secretory Leukocyte Peptidase Inhibitor ELISA kit
E01S0116-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Secretory Leukocyte Peptidase Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Secretory Leukocyte Peptidase Inhibitor ELISA kit
E01S0116-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Secretory Leukocyte Peptidase Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Secretory Leukocyte Peptidase Inhibitor ELISA kit
E01S0116-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Secretory Leukocyte Peptidase Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Dipeptidyl Peptidase 7 (DPP7) ELISA Kit
20-abx156815
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
20-abx151344
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
20-abx151346
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
20-abx151347
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Peptidase Inhibitor 16 (PI16) ELISA Kit
20-abx152731
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
20-abx153364
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
abx253879-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Dipeptidyl Peptidase 7 (DPP7) ELISA Kit
abx250440-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Dipeptidyl Peptidase 3 (DPP3) ELISA Kit
abx250450-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Dipeptidyl Peptidase 9 (DPP9) ELISA Kit
abx250714-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
abx252344-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human CTSC(Dipeptidyl peptidase 1) ELISA Kit
EH2248 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P53634
  • Alias: CTSC/DPPI/PALS/PLS/cathepsin C/EC 3.4.14.1/Cathepsin J/CPPIHMS/dipeptidyl peptidase 1/Dipeptidyl peptidase I/Dipeptidyl transferase/dipeptidyl-peptidase I/DPP1/DPPI/DPP-I/JP/JPD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human DPP6(Dipeptidyl Peptidase VI) ELISA Kit
EH2956 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: P42658
  • Alias: DPP6/DPPX/dipeptidyl aminopeptidase IV-related protein/dipeptidyl aminopeptidase-like protein 6/Dipeptidyl aminopeptidase-related protein/Dipeptidyl peptidase 6/Dipeptidyl peptidase IV-like p
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml
ELISA kit for Human Dipeptidyl peptidase 4
EK2398 96 tests
EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dipeptidyl peptidase 4 in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Dipeptidyl peptidase 2
EK2651 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dipeptidyl peptidase 2 in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Dipeptidyl peptidase 3
EK2665 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dipeptidyl peptidase 3 in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Dipeptidyl peptidase 9
EK3079 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dipeptidyl peptidase 9 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human DPP3/ Dipeptidyl peptidase 3 ELISA Kit
E0724Hu 1 Kit
EUR 605
Human DPP4/ Dipeptidyl peptidase 4 ELISA Kit
E0725Hu 1 Kit
EUR 537
Human DPP7/ Dipeptidyl peptidase 2 ELISA Kit
E0726Hu 1 Kit
EUR 605
Human DPP9/ Dipeptidyl peptidase 9 ELISA Kit
E0727Hu 1 Kit
EUR 605
Human CD26(Dipeptidyl peptidase 4) ELISA Kit
EH0003 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P27487
  • Alias: CD26/DPP4/CD26/ADABP/ADCP-2/ADCP2DPP IV/Adenosine deaminase complexing protein 2TP103/CD26 antigen/CD26T-cell activation antigen CD26/dipeptidyl peptidase 4/Dipeptidyl peptidase IV/dipeptidylp
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human DPP7(Dipeptidyl peptidase 2) ELISA Kit
EH1187 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q9UHL4
  • Alias: DPP7/DPPII/QPP/carboxytripeptidase/Dipeptidyl aminopeptidase II/dipeptidyl arylamidase II/dipeptidyl peptidase 2/Dipeptidyl peptidase 7/Dipeptidyl peptidase II/dipeptidyl-peptidase 7/DPP2/Quies
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
Human DPP3(Dipeptidyl peptidase 3) ELISA Kit
EH1196 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9NY33
  • Alias: DPP3/Dipeptidyl peptidase 3/Enkephalinase B/Dipeptidyl peptidase III/DPP III/Dipeptidyl aminopeptidase III
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human DPP9(Dipeptidyl peptidase 9) ELISA Kit
EH1437 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: Q86TI2
  • Alias: DPP9/DPLP9/DPRP2/DP9/DPP IX/DPRP-2/dipeptidyl peptidase 9/Dipeptidyl peptidase IV-related protein 2/Dipeptidyl peptidase IX/Dipeptidyl peptidase-like protein 9/dipeptidylpeptidase 9/dipeptidyl-
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml
Human Peptidase inhibitor 15, PI15 ELISA KIT
ELI-16022h 96 Tests
EUR 824
Human Tripeptidyl- peptidase 1, TPP1 ELISA KIT
ELI-16982h 96 Tests
EUR 824
Human Tripeptidyl- peptidase 2, TPP2 ELISA KIT
ELI-17203h 96 Tests
EUR 824
Human Peptidase inhibitor R3HDML, R3HDML ELISA KIT
ELI-10225h 96 Tests
EUR 824
Human Dipeptidyl peptidase 4, DPP4 ELISA KIT
ELI-02974h 96 Tests
EUR 824
Human Dipeptidyl peptidase 1, CTSC ELISA KIT
ELI-07453h 96 Tests
EUR 824
Human Dipeptidyl peptidase 9, DPP9 ELISA KIT
ELI-25981h 96 Tests
EUR 824
Human dipeptidyl peptidase â…£, DPPâ…£ ELISA Kit
CSB-E08518h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human dipeptidyl peptidase â…£, DPPâ…£ in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human dipeptidyl peptidase â…£, DPPâ…£ ELISA Kit
1-CSB-E08518h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human dipeptidyl peptidase â…£, DPPâ…£ in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human dipeptidyl peptidase  Ⅳ,DPPⅣ ELISA Kit
CSB-E08518h-96T 96T Ask for price
  • Sample Volume: 50-100ul
  • Detection Wavelength: 450 nm
  • Research Area: Immunology
  • Assay Principle: quantitative
  • Measurement: Sandwich
Description: DPPⅣ ELISA Kit for detection of human samples. No significant cross-reactivity or interference between human ANPEPand analogues was observed.
Human procollagen C peptidase,PCP ELISA Kit
CN-04587H1 96T
EUR 439
Human procollagen C peptidase,PCP ELISA Kit
CN-04587H2 48T
EUR 290
Human Procollagen C Peptidase (BMP1) ELISA Kit
abx351897-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx358322-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Peptidase inhibitor R3HDML (R3HDML) ELISA Kit
abx385338-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Vasoactive Peptidase Inhibitors (VPI) ELISA Kit
abx354525-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Mitochondrial intermediate peptidase (MIPEP) ELISA Kit
abx381455-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Pyroglutamyl-Peptidase I (PGPEP1) ELISA Kit
abx382184-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Dipeptidyl Peptidase 1 (CTSC) ELISA Kit
abx572354-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
abx572387-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Dipeptidyl Peptidase 1 (CTSC) ELISA Kit
abx520178-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.
Human procollagen C peptidase(PCP)ELISA Kit
GA-E0866HM-48T 48T
EUR 289
Human procollagen C peptidase(PCP)ELISA Kit
GA-E0866HM-96T 96T
EUR 466
Human Dipeptidyl peptidase 3, DPP3 ELISA KIT
ELI-32838h 96 Tests
EUR 824
Human Pyroglutamyl- peptidase 1, PGPEP1 ELISA KIT
ELI-35689h 96 Tests
EUR 824
Human Peptidase inhibitor 16, PI16 ELISA KIT
ELI-35708h 96 Tests
EUR 824
Human Leishmanolysin- like peptidase, LMLN ELISA KIT
ELI-39655h 96 Tests
EUR 824
Human Dipeptidyl peptidase 2, DPP7 ELISA KIT
ELI-47808h 96 Tests
EUR 824
Human Mitochondrial intermediate peptidase, MIPEP ELISA KIT
ELI-37246h 96 Tests
EUR 824
Human Dipeptidyl peptidase 8, DPP8 ELISA KIT
ELI-47653h 96 Tests
EUR 824
Human Peptidase Inhibitor 16(PI16)ELISA Kit
QY-E01314 96T
EUR 361
Human Peptidase Inhibitor 15(PI15)ELISA Kit
QY-E01315 96T
EUR 361
Human Tripeptidyl Peptidase I(TPP1)ELISA Kit
QY-E01705 96T
EUR 361
Human procollagen C peptidase(PCP)ELISA Kit
QY-E01929 96T
EUR 394
Human Dipeptidyl Peptidase 9(DPP9)ELISA Kit
QY-E03688 96T
EUR 361
Human Dipeptidyl Peptidase 8(DPP8)ELISA Kit
QY-E03689 96T
EUR 361
Human Dipeptidyl Peptidase 7(DPP7)ELISA Kit
QY-E03690 96T
EUR 361
Human Dipeptidyl Peptidase 6(DPP6)ELISA Kit
QY-E03691 96T
EUR 361
Human Dipeptidyl-Peptidase 4(DPP4)ELISA Kit
QY-E03693 96T
EUR 361
Human Dipeptidyl Peptidase 3(DPP3)ELISA Kit
QY-E03694 96T
EUR 361
Human Dipeptidyl Peptidase 10(DPP10)ELISA Kit
QY-E03695 96T
EUR 361
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RDR-TPP1-Hu-48Tests 48 Tests
EUR 544
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RDR-TPP1-Hu-96Tests 96 Tests
EUR 756
Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
RDR-TPP2-Hu-48Tests 48 Tests
EUR 544
Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
RDR-TPP2-Hu-96Tests 96 Tests
EUR 756
Human Dipeptidyl Peptidase IV ELISA Kit (DPP4)
RK01278 96 Tests
EUR 521
Human Dipeptidyl Peptidase 7 ELISA Kit (DPP7)
RK01279 96 Tests
EUR 521
Human Peptidase Inhibitor 16 ELISA Kit (PI16)
RK02071 96 Tests
EUR 521
Human Tripeptidyl Peptidase I ELISA Kit (TPP1)
RK02437 96 Tests
EUR 521
Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
RDR-DPP10-Hu-48Tests 48 Tests
EUR 544
Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
RDR-DPP10-Hu-96Tests 96 Tests
EUR 756
Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
RDR-DPP4-Hu-48Tests 48 Tests
EUR 500
Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
RDR-DPP4-Hu-96Tests 96 Tests
EUR 692
Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
RDR-DPP6-Hu-48Tests 48 Tests
EUR 544
Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
RDR-DPP6-Hu-96Tests 96 Tests
EUR 756
Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
RDR-DPP8-Hu-48Tests 48 Tests
EUR 544
Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
RDR-DPP8-Hu-96Tests 96 Tests
EUR 756
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RD-TPP1-Hu-48Tests 48 Tests
EUR 521
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RD-TPP1-Hu-96Tests 96 Tests
EUR 723
Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
RD-TPP2-Hu-48Tests 48 Tests
EUR 521
Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
RD-TPP2-Hu-96Tests 96 Tests
EUR 723
Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
SED908Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase 6 (DPP6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase 6 (DPP6) in serum, plasma, tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
SED908Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase 6 (DPP6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase 6 (DPP6) in serum, plasma, tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
SED908Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase 6 (DPP6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase 6 (DPP6) in serum, plasma, tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
SED908Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase 6 (DPP6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase 6 (DPP6) in serum, plasma, tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
4-SED908Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dipeptidyl Peptidase 6 elisa. Alternative names of the recognized antigen: DPPX
  • Dipeptidylpeptidase 6
  • Dipeptidyl aminopeptidase-like protein 6
  • Dipeptidyl aminopeptidase-related protein
  • Dipeptidyl peptidase IV-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidyl Peptidase 6 (DPP6) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Dipeptidyl Peptidase 7 (DPP7) ELISA Kit
SED909Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase 7 (DPP7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase 7 (DPP7) in serum, plasma, seminal plasma, tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase 7 (DPP7) ELISA Kit
SED909Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase 7 (DPP7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase 7 (DPP7) in serum, plasma, seminal plasma, tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase 7 (DPP7) ELISA Kit
SED909Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase 7 (DPP7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase 7 (DPP7) in serum, plasma, seminal plasma, tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase 7 (DPP7) ELISA Kit
SED909Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase 7 (DPP7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase 7 (DPP7) in serum, plasma, seminal plasma, tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase 7 (DPP7) ELISA Kit
4-SED909Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dipeptidyl Peptidase 7 elisa. Alternative names of the recognized antigen: DPP2
  • DPPII
  • QPP
  • Dipeptidylpeptidase 7
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidyl Peptidase 7 (DPP7) in samples from serum, plasma, seminal plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
SED927Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase 8 (DPP8) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase 8 (DPP8) in Tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
SED927Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase 8 (DPP8) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase 8 (DPP8) in Tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
SED927Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase 8 (DPP8) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase 8 (DPP8) in Tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
SED927Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase 8 (DPP8) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase 8 (DPP8) in Tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
4-SED927Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dipeptidyl Peptidase 8 elisa. Alternative names of the recognized antigen: DP8
  • DPRP1
  • MSTP141
  • MSTP097
  • MSTP135
  • dipeptidylpeptidase 8
  • Dipeptidyl Peptidase IV-Related Protein-1
  • Prolyl Dipeptidase DPP VIII
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidyl Peptidase 8 (DPP8) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
4-SEC828Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tripeptidyl Peptidase I elisa. Alternative names of the recognized antigen: CLN2
  • GIG1
  • LPIC
  • Tripeptidyl aminopeptidase
  • Lysosomal pepstatin-insensitive protease
  • Ceroid-Lipofuscinosis, Neuronal 2, Late Infantile
  • Cell growth-inhibitin
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
SEA884Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase IV (DPP4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase IV (DPP4) in serum, plasma, tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
SEA884Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase IV (DPP4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase IV (DPP4) in serum, plasma, tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
SEA884Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase IV (DPP4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase IV (DPP4) in serum, plasma, tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
SEA884Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase IV (DPP4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase IV (DPP4) in serum, plasma, tissue homogenates and other biological fluids.
Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
4-SEA884Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dipeptidyl Peptidase IV elisa. Alternative names of the recognized antigen: CD26
  • ADA
  • DPPIV
  • DPP-IV
  • ADABP
  • ADCP2
  • TP103
  • Adenosine Deaminase Complexing Protein 2
  • T-cell activation antigen CD26
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidyl Peptidase IV (DPP4) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
RD-DPP10-Hu-48Tests 48 Tests
EUR 521
Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
RD-DPP10-Hu-96Tests 96 Tests
EUR 723
Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
RD-DPP4-Hu-48Tests 48 Tests
EUR 478
Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
RD-DPP4-Hu-96Tests 96 Tests
EUR 662
Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
RD-DPP6-Hu-48Tests