Human PEPD(Peptidase D) ELISA Kit

Human PEPD(Peptidase D) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Human Peptidase D (PEPD) ELISA Kit
RDR-PEPD-Hu-48Tests 48 Tests
EUR 589
Human Peptidase D (PEPD) ELISA Kit
RDR-PEPD-Hu-96Tests 96 Tests
EUR 820
Human Peptidase D (PEPD) ELISA Kit
RD-PEPD-Hu-48Tests 48 Tests
EUR 563
Human Peptidase D (PEPD) ELISA Kit
RD-PEPD-Hu-96Tests 96 Tests
EUR 783
Human Peptidase D (PEPD) ELISA Kit
20-abx258121
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Peptidase D (PEPD) ELISA Kit
abx352384-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Peptidase D(PEPD)ELISA Kit
QY-E01316 96T
EUR 361
Human Peptidase D (PEPD) ELISA Kit
SEM011Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidase D (PEPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidase D (PEPD) in serum, plasma, tissue homogenates and other biological fluids.
Human Peptidase D (PEPD) ELISA Kit
SEM011Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidase D (PEPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidase D (PEPD) in serum, plasma, tissue homogenates and other biological fluids.
Human Peptidase D (PEPD) ELISA Kit
SEM011Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidase D (PEPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidase D (PEPD) in serum, plasma, tissue homogenates and other biological fluids.
Human Peptidase D (PEPD) ELISA Kit
SEM011Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidase D (PEPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidase D (PEPD) in serum, plasma, tissue homogenates and other biological fluids.
Human Peptidase D (PEPD) ELISA Kit
4-SEM011Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Peptidase D elisa. Alternative names of the recognized antigen: PRD
  • Xaa-Pro Dipeptidase
  • Prolidase
  • Imidodipeptidase
  • Proline dipeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Peptidase D (PEPD) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Peptidase D (PEPD) Antibody
20-abx004149
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peptidase D (PEPD) Antibody
abx036679-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Peptidase D (PEPD) Antibody
20-abx129281
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Peptidase D (PEPD) Antibody
20-abx173976
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Peptidase D (PEPD) Antibody
20-abx318754
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Peptidase D (PEPD) Antibody
abx236307-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Recombinant Peptidase D (PEPD)
4-RPM011Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P12955
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Peptidase D expressed in: E.coli
ELISA kit for Human PEPD (Peptidase D)
E-EL-H5575 1 plate of 96 wells
EUR 534
  • Gentaur's PEPD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PEPD. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PEPD (Peptidase D) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human PEPD (Peptidase D)
ELK6673 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Peptidase D (PEPD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Peptidase D (PE
  • Show more
Description: A sandwich ELISA kit for detection of Peptidase D from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Peptidase D (PEPD) CLIA Kit
20-abx496011
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Peptidase D (PEPD) Protein
20-abx167041
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Peptidase D (PEPD) Antibody (HRP)
20-abx315913
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Peptidase D (PEPD) Antibody (FITC)
20-abx315914
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Peptidase D (PEPD) Antibody (Biotin)
20-abx315915
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PEPD Peptidase D Human Recombinant Protein
PROTP12955 Regular: 20ug
EUR 317
Description: PEPD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 516 amino acids (1-493a.a.) and having a molecular mass of 56.9kDa.;PEPD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Peptidase D (PEPD) Polyclonal Antibody (Human)
4-PAM011Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD)
Peptidase D (PEPD) Polyclonal Antibody (Human), APC
4-PAM011Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with APC.
Peptidase D (PEPD) Polyclonal Antibody (Human), Biotinylated
4-PAM011Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with Biotin.
Peptidase D (PEPD) Polyclonal Antibody (Human), Cy3
4-PAM011Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with Cy3.
Peptidase D (PEPD) Polyclonal Antibody (Human), FITC
4-PAM011Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with FITC.
Peptidase D (PEPD) Polyclonal Antibody (Human), HRP
4-PAM011Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with HRP.
Peptidase D (PEPD) Polyclonal Antibody (Human), PE
4-PAM011Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with PE.
Peptidase D (PEPD) Polyclonal Antibody (Human), APC-Cy7
4-PAM011Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PEPD (Ala2~Lys493)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with APC-Cy7.
Human PEPD ELISA Kit
ELA-E9177h 96 Tests
EUR 824
PEPD ELISA KIT|Human
EF006487 96 Tests
EUR 689
PEPD ELISA Kit (Human) (OKCD09349)
OKCD09349 96 Wells
EUR 909
Description: Description of target: Xaa-Pro dipeptidase is a cytosolic dipeptidase that hydrolyzes dipeptides with proline or hydroxyproline at the carboxy terminus (but not Pro-Pro). It is important in collagen metabolism because of the high levels of iminoacids.Xaa-Pro dipeptidase is a cytosolic dipeptidase that hydrolyzes dipeptides with proline or hydroxyproline at the carboxy terminus (but not Pro-Pro). It is important in collagen metabolism because of the high levels of iminoacids. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications. PRIMARYREFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-74 DC395475.1 1-74 75-101 DC385464.1 1-27 102-2018 BC015027.1 1-1917;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.63ng/mL
PEPD ELISA Kit (Human) (OKEH01924)
OKEH01924 96 Wells
EUR 779
Description: Description of target: This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.43 ng/mL
Peptidase D antibody
70R-4294 50 ug
EUR 467
Description: Rabbit polyclonal Peptidase D antibody raised against the middle region of PEPD
Peptidase D Antibody
20-abx114368
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Peptidase D Blocking Peptide
33R-4964 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PEPD antibody, catalog no. 70R-4294
PEPD ELISA Kit (Mouse) (OKCA02477)
OKCA02477 96 Wells
EUR 846
Description: Description of target: Splits dipeptides with a prolyl or hydroxyprolyl residue in the C-terminal position. Plays an important role in collagen metabolism because of the high level of iminoacids in collagen. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 3.9 mU/mL
PEPD ELISA Kit (Rat) (OKEH03731)
OKEH03731 96 Wells
EUR 779
Description: Description of target: Splits dipeptides with a prolyl or hydroxyprolyl residue in the C-terminal position. Plays an important role in collagen metabolism because of the high level of iminoacids in collagen.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.312 ng/mL
Human Xaa-Pro dipeptidase (PEPD) ELISA Kit
abx251813-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Human PEPD(Xaa-Pro dipeptidase) ELISA Kit
EH2449 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: P12955
  • Alias: PEPD/Proline dipeptidase(Prolidase)/Imidodipeptidase/Peptidase D/PRD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml
Human PEPD/ Xaa-Pro dipeptidase ELISA Kit
E1906Hu 1 Kit
EUR 605
Human Xaa- Pro dipeptidase, PEPD ELISA KIT
ELI-07707h 96 Tests
EUR 824
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
PEPD antibody
70R-19212 50 ul
EUR 435
Description: Rabbit polyclonal PEPD antibody
PEPD Antibody
32842-100ul 100ul
EUR 252
PEPD antibody
10R-5236 100 ul
EUR 691
Description: Mouse monoclonal PEPD antibody
PEPD Antibody
43029-100ul 100ul
EUR 252
PEPD Antibody
DF7333 200ul
EUR 304
Description: PEPD Antibody detects endogenous levels of total PEPD.
PEPD Antibody
1-CSB-PA017784GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PEPD. Recognizes PEPD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
PEPD Antibody
1-CSB-PA017784LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEPD. Recognizes PEPD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
PEPD siRNA
20-abx903940
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PEPD siRNA
20-abx928247
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PEPD siRNA
20-abx928248
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PEPD Antibody
ABD7333 100 ug
EUR 438
anti-PEPD
YF-PA13713 50 ul
EUR 363
Description: Mouse polyclonal to PEPD
anti-PEPD
YF-PA13714 50 ug
EUR 363
Description: Mouse polyclonal to PEPD
anti-PEPD
YF-PA13715 100 ul
EUR 403
Description: Rabbit polyclonal to PEPD
anti-PEPD
YF-PA13716 100 ug
EUR 403
Description: Rabbit polyclonal to PEPD
anti-PEPD
YF-PA24341 50 ul
EUR 334
Description: Mouse polyclonal to PEPD
Human Xaa-Pro Dipeptidase/Prolidase(PEPD) ELISA Kit
CSB-E16196h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Xaa-Pro Dipeptidase/Prolidase(PEPD) ELISA Kit
1-CSB-E16196h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Xaa-Pro Dipeptidase/Prolidase(PEPD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human PEPD shRNA Plasmid
20-abx953458
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PEPD Recombinant Protein (Human)
RP023089 100 ug Ask for price
PEPD Recombinant Protein (Human)
RP023092 100 ug Ask for price
Mouse Xaa-Pro dipeptidase(PEPD) ELISA kit
CSB-EL017784MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Xaa-Pro dipeptidase (PEPD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Xaa-Pro dipeptidase(PEPD) ELISA kit
1-CSB-EL017784MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Xaa-Pro dipeptidase(PEPD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat Xaa-Pro dipeptidase (PEPD) ELISA Kit
abx256674-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Rat Pepd/ Xaa-Pro dipeptidase ELISA Kit
E0748Ra 1 Kit
EUR 646
Rat Xaa- Pro dipeptidase, Pepd ELISA KIT
ELI-07705r 96 Tests
EUR 886
Mouse Xaa- Pro dipeptidase, Pepd ELISA KIT
ELI-07706m 96 Tests
EUR 865
Mouse Xaa-Pro dipeptidase (PEPD) ELISA Kit
abx521027-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Rat Pepd(Xaa-Pro dipeptidase) ELISA Kit
ER0699 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q5I0D7
  • Alias: Pepd/Proline dipeptidase(Prolidase)/Imidodipeptidase/Peptidase D/PRD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml
Pepd ELISA Kit| Rat Xaa-Pro dipeptidase ELISA Kit
EF017512 96 Tests
EUR 689
Pepd ELISA Kit| Mouse Xaa-Pro dipeptidase ELISA Kit
EF015818 96 Tests
EUR 689
ELISA kit for Human Xaa-Pro Dipeptidase/Prolidase (PEPD)
KTE61249-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Xaa-Pro Dipeptidase/Prolidase (PEPD)
KTE61249-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Xaa-Pro Dipeptidase/Prolidase (PEPD)
KTE61249-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
PEPD Blocking Peptide
DF7333-BP 1mg
EUR 195
PEPD Conjugated Antibody
C43029 100ul
EUR 397
PEPD Conjugated Antibody
C32842 100ul
EUR 397
PEPD cloning plasmid
CSB-CL017784HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggcggcggccaccggaccctcgttttggctggggaatgaaaccctgaaggtgccgctggcgctctttgccttgaaccggcagcgcctgtgtgagcggctgcggaagaaccctgctgtgcaggccggctccatcgtggtcctgcagggcggggaggagactcagcgctactgca
  • Show more
Description: A cloning plasmid for the PEPD gene.
PEPD cloning plasmid
CSB-CL017784HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggcggcggccaccggaccctcgttttggctggggaatgaaaccctgaaggtgccgctggcgctctttgccttgaaccggcagcgcctgtgtgagcggctgcggaagaaccctgctgtgcaggccggctccatcgtggtcctgcagggcggggaggagactcagcgctactgca
  • Show more
Description: A cloning plasmid for the PEPD gene.
PEPD Rabbit pAb
A5416-100ul 100 ul
EUR 308
PEPD Rabbit pAb
A5416-200ul 200 ul
EUR 459
PEPD Rabbit pAb
A5416-20ul 20 ul
EUR 183
PEPD Rabbit pAb
A5416-50ul 50 ul
EUR 223
anti- PEPD antibody
FNab06307 100µg
EUR 585
  • Immunogen: peptidase D
  • Uniprot ID: P12955
  • Gene ID: 5184
  • Research Area: Metabolism
Description: Antibody raised against PEPD
Anti-PEPD antibody
PAab06307 100 ug
EUR 412
pCMV-SPORT6-PEPD
PVT13160 2 ug
EUR 391
Anti-PEPD antibody
STJ27369 100 µl
EUR 277
Description: This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.
PEPD ORF Vector (Human) (pORF)
ORF007697 1.0 ug DNA
EUR 95
PEPD ORF Vector (Human) (pORF)
ORF007698 1.0 ug DNA
EUR 95

Human PEPD(Peptidase D) ELISA Kit

Scroll to Top