Human PEPD(Peptidase D) ELISA Kit

Human PEPD(Peptidase D) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Human Peptidase D (PEPD) ELISA Kit
RD-PEPD-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Peptidase D (PEPD) ELISA Kit
RD-PEPD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Peptidase D (PEPD) ELISA Kit
RDR-PEPD-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Peptidase D (PEPD) ELISA Kit
RDR-PEPD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Peptidase D (PEPD) ELISA Kit
abx352384-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Peptidase D (PEPD) ELISA Kit
20-abx258121	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Peptidase D(PEPD)ELISA Kit
QY-E01316	Qayee Biotechnology	96T	EUR 361

Human Peptidase D (PEPD) ELISA Kit
SEM011Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidase D (PEPD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidase D (PEPD) in serum, plasma, tissue homogenates and other biological fluids.

Human Peptidase D (PEPD) ELISA Kit
SEM011Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidase D (PEPD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidase D (PEPD) in serum, plasma, tissue homogenates and other biological fluids.

Human Peptidase D (PEPD) ELISA Kit
SEM011Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidase D (PEPD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidase D (PEPD) in serum, plasma, tissue homogenates and other biological fluids.

Human Peptidase D (PEPD) ELISA Kit
SEM011Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidase D (PEPD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidase D (PEPD) in serum, plasma, tissue homogenates and other biological fluids.

Human Peptidase D (PEPD) ELISA Kit
4-SEM011Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Peptidase D elisa. Alternative names of the recognized antigen: PRD Xaa-Pro Dipeptidase Prolidase Imidodipeptidase Proline dipeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Peptidase D (PEPD) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Peptidase D (PEPD) Antibody
20-abx129281	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Peptidase D (PEPD) Antibody
abx036679-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Peptidase D (PEPD) Antibody
20-abx004149	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Peptidase D (PEPD) Antibody
20-abx173976	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Peptidase D (PEPD) Antibody
20-abx318754	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peptidase D (PEPD) Antibody
abx236307-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Recombinant Peptidase D (PEPD)
4-RPM011Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P12955 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 58.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Peptidase D expressed in: E.coli

ELISA kit for Human PEPD (Peptidase D)
E-EL-H5575	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PEPD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PEPD. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PEPD (Peptidase D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PEPD (Peptidase D)
ELK6673	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Peptidase D (PEPD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Peptidase D (PE Show more
Description: A sandwich ELISA kit for detection of Peptidase D from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Peptidase D (PEPD) CLIA Kit
20-abx496011	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Peptidase D (PEPD) Protein
20-abx167041	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Peptidase D (PEPD) Antibody (HRP)
20-abx315913	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peptidase D (PEPD) Antibody (FITC)
20-abx315914	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peptidase D (PEPD) Antibody (Biotin)
20-abx315915	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PEPD Peptidase D Human Recombinant Protein
PROTP12955	BosterBio	Regular: 20ug	EUR 317
Description: PEPD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 516 amino acids (1-493a.a.) and having a molecular mass of 56.9kDa.;PEPD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Peptidase D (PEPD) Polyclonal Antibody (Human)
4-PAM011Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PEPD (Ala2~Lys493) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD)

Peptidase D (PEPD) Polyclonal Antibody (Human), APC
4-PAM011Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PEPD (Ala2~Lys493) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with APC.

Peptidase D (PEPD) Polyclonal Antibody (Human), Biotinylated
4-PAM011Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PEPD (Ala2~Lys493) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with Biotin.

Peptidase D (PEPD) Polyclonal Antibody (Human), Cy3
4-PAM011Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PEPD (Ala2~Lys493) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with Cy3.

Peptidase D (PEPD) Polyclonal Antibody (Human), FITC
4-PAM011Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PEPD (Ala2~Lys493) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with FITC.

Peptidase D (PEPD) Polyclonal Antibody (Human), HRP
4-PAM011Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PEPD (Ala2~Lys493) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with HRP.

Peptidase D (PEPD) Polyclonal Antibody (Human), PE
4-PAM011Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PEPD (Ala2~Lys493) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with PE.

Peptidase D (PEPD) Polyclonal Antibody (Human), APC-Cy7
4-PAM011Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PEPD (Ala2~Lys493) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidase D (PEPD). This antibody is labeled with APC-Cy7.

Human PEPD ELISA Kit
ELA-E9177h	Lifescience Market	96 Tests	EUR 824

PEPD ELISA KIT|Human
EF006487	Lifescience Market	96 Tests	EUR 689

PEPD ELISA Kit (Human) (OKCD09349)
OKCD09349	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Xaa-Pro dipeptidase is a cytosolic dipeptidase that hydrolyzes dipeptides with proline or hydroxyproline at the carboxy terminus (but not Pro-Pro). It is important in collagen metabolism because of the high levels of iminoacids.Xaa-Pro dipeptidase is a cytosolic dipeptidase that hydrolyzes dipeptides with proline or hydroxyproline at the carboxy terminus (but not Pro-Pro). It is important in collagen metabolism because of the high levels of iminoacids. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications. PRIMARYREFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-74 DC395475.1 1-74 75-101 DC385464.1 1-27 102-2018 BC015027.1 1-1917;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.63ng/mL

PEPD ELISA Kit (Human) (OKEH01924)
OKEH01924	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.43 ng/mL

Peptidase D Antibody
20-abx114368	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Peptidase D antibody
70R-4294	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Peptidase D antibody raised against the middle region of PEPD

Peptidase D Blocking Peptide
33R-4964	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PEPD antibody, catalog no. 70R-4294

PEPD ELISA Kit (Rat) (OKEH03731)
OKEH03731	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Splits dipeptides with a prolyl or hydroxyprolyl residue in the C-terminal position. Plays an important role in collagen metabolism because of the high level of iminoacids in collagen.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.312 ng/mL

PEPD ELISA Kit (Mouse) (OKCA02477)
OKCA02477	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Splits dipeptides with a prolyl or hydroxyprolyl residue in the C-terminal position. Plays an important role in collagen metabolism because of the high level of iminoacids in collagen. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 3.9 mU/mL

Human PEPD/ Xaa-Pro dipeptidase ELISA Kit
E1906Hu	Sunlong	1 Kit	EUR 605

Human PEPD(Xaa-Pro dipeptidase) ELISA Kit
EH2449	FN Test	96T	EUR 524.1
Detection range: 3.125-200 ng/ml Uniprot ID: P12955 Alias: PEPD/Proline dipeptidase(Prolidase)/Imidodipeptidase/Peptidase D/PRD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human Xaa- Pro dipeptidase, PEPD ELISA KIT
ELI-07707h	Lifescience Market	96 Tests	EUR 824

Human Xaa-Pro dipeptidase (PEPD) ELISA Kit
abx251813-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

PEPD siRNA
20-abx903940	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PEPD siRNA
20-abx928247	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PEPD siRNA
20-abx928248	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PEPD Antibody
ABD7333	Lifescience Market	100 ug	EUR 438

PEPD Antibody
43029-100ul	SAB	100ul	EUR 252

PEPD Antibody
32842-100ul	SAB	100ul	EUR 252

PEPD antibody
10R-5236	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal PEPD antibody

PEPD antibody
70R-19212	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PEPD antibody

PEPD Antibody
DF7333	Affbiotech	200ul	EUR 304
Description: PEPD Antibody detects endogenous levels of total PEPD.

PEPD Antibody
1-CSB-PA017784GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PEPD. Recognizes PEPD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PEPD Antibody
1-CSB-PA017784LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEPD. Recognizes PEPD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

anti-PEPD
YF-PA13713	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to PEPD

anti-PEPD
YF-PA13714	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to PEPD

anti-PEPD
YF-PA13715	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to PEPD

anti-PEPD
YF-PA13716	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to PEPD

anti-PEPD
YF-PA24341	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to PEPD

Human Xaa-Pro Dipeptidase/Prolidase(PEPD) ELISA Kit
CSB-E16196h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Xaa-Pro Dipeptidase/Prolidase(PEPD) ELISA Kit
1-CSB-E16196h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Xaa-Pro Dipeptidase/Prolidase(PEPD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human PEPD shRNA Plasmid
20-abx953458	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PEPD Recombinant Protein (Human)
RP023089	ABM	100 ug	Ask for price

PEPD Recombinant Protein (Human)
RP023092	ABM	100 ug	Ask for price

Mouse Xaa-Pro dipeptidase (PEPD) ELISA Kit
abx521027-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Pepd/ Xaa-Pro dipeptidase ELISA Kit
E0748Ra	Sunlong	1 Kit	EUR 646

Rat Xaa- Pro dipeptidase, Pepd ELISA KIT
ELI-07705r	Lifescience Market	96 Tests	EUR 886

Mouse Xaa- Pro dipeptidase, Pepd ELISA KIT
ELI-07706m	Lifescience Market	96 Tests	EUR 865

Rat Pepd(Xaa-Pro dipeptidase) ELISA Kit
ER0699	FN Test	96T	EUR 567.6
Detection range: 0.625-40 ng/ml Uniprot ID: Q5I0D7 Alias: Pepd/Proline dipeptidase(Prolidase)/Imidodipeptidase/Peptidase D/PRD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml

Rat Xaa-Pro dipeptidase (PEPD) ELISA Kit
abx256674-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Xaa-Pro dipeptidase(PEPD) ELISA kit
CSB-EL017784MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Xaa-Pro dipeptidase (PEPD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Xaa-Pro dipeptidase(PEPD) ELISA kit
1-CSB-EL017784MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Xaa-Pro dipeptidase(PEPD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pepd ELISA Kit| Mouse Xaa-Pro dipeptidase ELISA Kit
EF015818	Lifescience Market	96 Tests	EUR 689

Pepd ELISA Kit| Rat Xaa-Pro dipeptidase ELISA Kit
EF017512	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Xaa-Pro Dipeptidase/Prolidase (PEPD)
KTE61249-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Xaa-Pro Dipeptidase/Prolidase (PEPD)
KTE61249-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Xaa-Pro Dipeptidase/Prolidase (PEPD)
KTE61249-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PEPD Conjugated Antibody
C43029	SAB	100ul	EUR 397

PEPD Conjugated Antibody
C32842	SAB	100ul	EUR 397

PEPD cloning plasmid
CSB-CL017784HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1482 Sequence: atggcggcggccaccggaccctcgttttggctggggaatgaaaccctgaaggtgccgctggcgctctttgccttgaaccggcagcgcctgtgtgagcggctgcggaagaaccctgctgtgcaggccggctccatcgtggtcctgcagggcggggaggagactcagcgctactgca Show more
Description: A cloning plasmid for the PEPD gene.

PEPD cloning plasmid
CSB-CL017784HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1482 Sequence: atggcggcggccaccggaccctcgttttggctggggaatgaaaccctgaaggtgccgctggcgctctttgccttgaaccggcagcgcctgtgtgagcggctgcggaagaaccctgctgtgcaggccggctccatcgtggtcctgcagggcggggaggagactcagcgctactgca Show more
Description: A cloning plasmid for the PEPD gene.

anti- PEPD antibody
FNab06307	FN Test	100µg	EUR 585
Immunogen: peptidase D Uniprot ID: P12955 Gene ID: 5184 Research Area: Metabolism
Description: Antibody raised against PEPD

PEPD Rabbit pAb
A5416-100ul	Abclonal	100 ul	EUR 308

PEPD Rabbit pAb
A5416-200ul	Abclonal	200 ul	EUR 459

PEPD Rabbit pAb
A5416-20ul	Abclonal	20 ul	EUR 183

PEPD Rabbit pAb
A5416-50ul	Abclonal	50 ul	EUR 223

PEPD Blocking Peptide
DF7333-BP	Affbiotech	1mg	EUR 195

Anti-PEPD antibody
PAab06307	Lifescience Market	100 ug	EUR 412

pCMV-SPORT6-PEPD
PVT13160	Lifescience Market	2 ug	EUR 391

Anti-PEPD antibody
STJ27369	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.

PEPD ORF Vector (Human) (pORF)
ORF007697	ABM	1.0 ug DNA	EUR 95

PEPD ORF Vector (Human) (pORF)
ORF007698	ABM	1.0 ug DNA	EUR 95

Human Dipeptidyl Peptidase IV ELISA kit
E01D0039-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidyl Peptidase IV in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dipeptidyl Peptidase IV ELISA kit
E01D0039-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidyl Peptidase IV in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dipeptidyl Peptidase IV ELISA kit
E01D0039-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidyl Peptidase IV in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Procollagen C peptidase ELISA kit
E01P0624-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Procollagen C peptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Procollagen C peptidase ELISA kit
E01P0624-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Procollagen C peptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Procollagen C peptidase ELISA kit
E01P0624-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Procollagen C peptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Peptidase Inhibitor 3 ELISA kit
E01P0744-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Peptidase Inhibitor 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Peptidase Inhibitor 3 ELISA kit
E01P0744-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Peptidase Inhibitor 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Peptidase Inhibitor 3 ELISA kit
E01P0744-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Peptidase Inhibitor 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dipeptidyl Peptidase 10 ELISA Kit
ELA-E12621h	Lifescience Market	96 Tests	EUR 824

Human LAP(Leucine Peptidase) ELISA Kit
EH0162	FN Test	96T	EUR 524.1
Detection range: 0.781-50 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Kyphoscoliosis peptidase, KY ELISA KIT
ELI-46534h	Lifescience Market	96 Tests	EUR 824

Human Kyphoscoliosis Peptidase(KY)ELISA Kit
QY-E02929	Qayee Biotechnology	96T	EUR 361

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

14,15-DHET Human Urine ELISA Kit
DH3	Detroit R&D	1 Kit	EUR 323

Rat PEPD shRNA Plasmid
20-abx988584	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PEPD protein (His tag)
80R-4114	Fitzgerald	100 ug	EUR 327
Description: Recombinant Human PEPD protein (His tag)

Mouse PEPD shRNA Plasmid
20-abx971997	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PEPD Antibody, HRP conjugated
1-CSB-PA017784LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEPD. Recognizes PEPD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PEPD Antibody, FITC conjugated
1-CSB-PA017784LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEPD. Recognizes PEPD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PEPD Antibody, Biotin conjugated
1-CSB-PA017784LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEPD. Recognizes PEPD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

anti-PEPD (1D5-H3)
LF-MA10221	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PEPD

PEPD Recombinant Protein (Rat)
RP220043	ABM	100 ug	Ask for price

pCMV-SPORT6-PEPD Plasmid
PVT16130	Lifescience Market	2 ug	EUR 325

PEPD Recombinant Protein (Mouse)
RP161330	ABM	100 ug	Ask for price

Anti-PEPD (4A5-D10)
YF-MA20384	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PEPD

Fmoc-D-Ala-SASRIN resin (200-400 mesh, 0.5-0.8 mmol/g)
D-1425.0001	Bachem	1.0g	EUR 236

Fmoc-D-Ala-SASRIN resin (200-400 mesh, 0.5-0.8 mmol/g)
D-1425.0005	Bachem	5.0g	EUR 841

Boc-D-Ala-PAM resin (200-400 mesh, 0.4-0.7 mmol/g)
D-1495.0001	Bachem	1.0g	EUR 381

Boc-D-Ala-PAM resin (200-400 mesh, 0.4-0.7 mmol/g)
D-1495.0005	Bachem	5.0g	EUR 1421

Boc-D-Asn-PAM resin (200-400 mesh, 0.4-0.7 mmol/g)
D-1570.0001	Bachem	1.0g	EUR 122

Boc-D-Asn-PAM resin (200-400 mesh, 0.4-0.7 mmol/g)
D-1570.0005	Bachem	5.0g	EUR 381

Fmoc-D-Leu-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)
D-1765.0001	Bachem	1.0g	EUR 261

Fmoc-D-Leu-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)
D-1765.0005	Bachem	5.0g	EUR 925

Fmoc-D-Phe-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)
D-1770.0001	Bachem	1.0g	EUR 261

Fmoc-D-Phe-SASRIN resin (200-400 mesh, 0.4-0.7 mmol/g)
D-1770.0005	Bachem	5.0g	EUR 925

Fmoc-D-Val-Wang resin (200-400 mesh, 0.6-0.9 mmol/g)
D-2465.0001	Bachem	1.0g	EUR 176

Fmoc-D-Val-Wang resin (200-400 mesh, 0.6-0.9 mmol/g)
D-2465.0005	Bachem	5.0g	EUR 611

Fmoc-D-Leu-Wang resin (200-400 mesh, 0.50-1.00 mmol/g)
D-2535.0001	Bachem	1.0g	EUR 151

Fmoc-D-Leu-Wang resin (200-400 mesh, 0.50-1.00 mmol/g)
D-2535.0005	Bachem	5.0g	EUR 515

Fmoc-D-Val-SASRIN resin (200-400 mesh, 0.5-0.8 mmol/g)
D-2690.0001	Bachem	1.0g	EUR 145

Fmoc-D-Val-SASRIN resin (200-400 mesh, 0.5-0.8 mmol/g)
D-2690.0005	Bachem	5.0g	EUR 477

PEPD sgRNA CRISPR Lentivector set (Human)
K1627701	ABM	3 x 1.0 ug	EUR 339

Human Dipeptidyl Peptidase 1 (CTSC) ELISA Kit
abx520178-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Dipeptidyl Peptidase 1 (CTSC) ELISA Kit
abx572354-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
abx572387-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

ELISA kit for Human DPP6 (Dipeptidyl Peptidase ?)
E-EL-H2390	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's DPP6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DPP6. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DPP6 (Dipeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant

Human CTSC/ Dipeptidyl peptidase 1 ELISA Kit
E0597Hu	Sunlong	1 Kit	EUR 571

Human Serine peptidase inhibitors K1 ELISA kit
E01S0027-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Serine peptidase inhibitors K1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Serine peptidase inhibitors K1 ELISA kit
E01S0027-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Serine peptidase inhibitors K1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Serine peptidase inhibitors K1 ELISA kit
E01S0027-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Serine peptidase inhibitors K1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Secretory Leukocyte Peptidase Inhibitor ELISA kit
E01S0116-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Secretory Leukocyte Peptidase Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Secretory Leukocyte Peptidase Inhibitor ELISA kit
E01S0116-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Secretory Leukocyte Peptidase Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Secretory Leukocyte Peptidase Inhibitor ELISA kit
E01S0116-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Secretory Leukocyte Peptidase Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Dipeptidyl peptidase 4
EK2398	SAB	96 tests	EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dipeptidyl peptidase 4 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Dipeptidyl peptidase 2
EK2651	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dipeptidyl peptidase 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Dipeptidyl peptidase 3
EK2665	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dipeptidyl peptidase 3 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Dipeptidyl peptidase 9
EK3079	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dipeptidyl peptidase 9 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human DPP3/ Dipeptidyl peptidase 3 ELISA Kit
E0724Hu	Sunlong	1 Kit	EUR 605

Human DPP4/ Dipeptidyl peptidase 4 ELISA Kit
E0725Hu	Sunlong	1 Kit	EUR 537

Human DPP7/ Dipeptidyl peptidase 2 ELISA Kit
E0726Hu	Sunlong	1 Kit	EUR 605

Human DPP9/ Dipeptidyl peptidase 9 ELISA Kit
E0727Hu	Sunlong	1 Kit	EUR 605

Human CD26(Dipeptidyl peptidase 4) ELISA Kit
EH0003	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P27487 Alias: CD26/DPP4/CD26/ADABP/ADCP-2/ADCP2DPP IV/Adenosine deaminase complexing protein 2TP103/CD26 antigen/CD26T-cell activation antigen CD26/dipeptidyl peptidase 4/Dipeptidyl peptidase IV/dipeptidylp Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human DPP7(Dipeptidyl peptidase 2) ELISA Kit
EH1187	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q9UHL4 Alias: DPP7/DPPII/QPP/carboxytripeptidase/Dipeptidyl aminopeptidase II/dipeptidyl arylamidase II/dipeptidyl peptidase 2/Dipeptidyl peptidase 7/Dipeptidyl peptidase II/dipeptidyl-peptidase 7/DPP2/Quies Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human DPP3(Dipeptidyl peptidase 3) ELISA Kit
EH1196	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q9NY33 Alias: DPP3/Dipeptidyl peptidase 3/Enkephalinase B/Dipeptidyl peptidase III/DPP III/Dipeptidyl aminopeptidase III
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human DPP9(Dipeptidyl peptidase 9) ELISA Kit
EH1437	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: Q86TI2 Alias: DPP9/DPLP9/DPRP2/DP9/DPP IX/DPRP-2/dipeptidyl peptidase 9/Dipeptidyl peptidase IV-related protein 2/Dipeptidyl peptidase IX/Dipeptidyl peptidase-like protein 9/dipeptidylpeptidase 9/dipeptidyl- Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human CTSC(Dipeptidyl peptidase 1) ELISA Kit
EH2248	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P53634 Alias: CTSC/DPPI/PALS/PLS/cathepsin C/EC 3.4.14.1/Cathepsin J/CPPIHMS/dipeptidyl peptidase 1/Dipeptidyl peptidase I/Dipeptidyl transferase/dipeptidyl-peptidase I/DPP1/DPPI/DPP-I/JP/JPD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human DPP6(Dipeptidyl Peptidase VI) ELISA Kit
EH2956	FN Test	96T	EUR 524.1
Detection range: 3.125-200 ng/ml Uniprot ID: P42658 Alias: DPP6/DPPX/dipeptidyl aminopeptidase IV-related protein/dipeptidyl aminopeptidase-like protein 6/Dipeptidyl aminopeptidase-related protein/Dipeptidyl peptidase 6/Dipeptidyl peptidase IV-like p Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human Peptidase inhibitor R3HDML, R3HDML ELISA KIT
ELI-10225h	Lifescience Market	96 Tests	EUR 824

Human Dipeptidyl peptidase 9, DPP9 ELISA KIT
ELI-25981h	Lifescience Market	96 Tests	EUR 824

Human Dipeptidyl peptidase 4, DPP4 ELISA KIT
ELI-02974h	Lifescience Market	96 Tests	EUR 824

Human Dipeptidyl peptidase 1, CTSC ELISA KIT
ELI-07453h	Lifescience Market	96 Tests	EUR 824

Human Peptidase inhibitor 15, PI15 ELISA KIT
ELI-16022h	Lifescience Market	96 Tests	EUR 824

Human Tripeptidyl- peptidase 1, TPP1 ELISA KIT
ELI-16982h	Lifescience Market	96 Tests	EUR 824

Human Tripeptidyl- peptidase 2, TPP2 ELISA KIT
ELI-17203h	Lifescience Market	96 Tests	EUR 824

Human procollagen C peptidase(PCP)ELISA Kit
GA-E0866HM-48T	GenAsia Biotech	48T	EUR 289

Human procollagen C peptidase(PCP)ELISA Kit
GA-E0866HM-96T	GenAsia Biotech	96T	EUR 466

Human Dipeptidyl peptidase 3, DPP3 ELISA KIT
ELI-32838h	Lifescience Market	96 Tests	EUR 824

Human Pyroglutamyl- peptidase 1, PGPEP1 ELISA KIT
ELI-35689h	Lifescience Market	96 Tests	EUR 824

Human Peptidase inhibitor 16, PI16 ELISA KIT
ELI-35708h	Lifescience Market	96 Tests	EUR 824

Human Mitochondrial intermediate peptidase, MIPEP ELISA KIT
ELI-37246h	Lifescience Market	96 Tests	EUR 824

Human Dipeptidyl peptidase 8, DPP8 ELISA KIT
ELI-47653h	Lifescience Market	96 Tests	EUR 824

Human Leishmanolysin- like peptidase, LMLN ELISA KIT
ELI-39655h	Lifescience Market	96 Tests	EUR 824

Human Dipeptidyl peptidase 2, DPP7 ELISA KIT
ELI-47808h	Lifescience Market	96 Tests	EUR 824

Human Dipeptidyl Peptidase 7 (DPP7) ELISA Kit
20-abx156815	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
20-abx153364	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
20-abx151344	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
20-abx151346	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
20-abx151347	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
20-abx152731	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Procollagen C Peptidase (BMP1) ELISA Kit
abx351897-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Vasoactive Peptidase Inhibitors (VPI) ELISA Kit
abx354525-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Mitochondrial intermediate peptidase (MIPEP) ELISA Kit
abx381455-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Pyroglutamyl-Peptidase I (PGPEP1) ELISA Kit
abx382184-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx358322-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Peptidase inhibitor R3HDML (R3HDML) ELISA Kit
abx385338-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Dipeptidyl Peptidase 9 (DPP9) ELISA Kit
abx250714-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
abx252344-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
abx253879-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Dipeptidyl Peptidase 7 (DPP7) ELISA Kit
abx250440-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Dipeptidyl Peptidase 3 (DPP3) ELISA Kit
abx250450-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human procollagen C peptidase,PCP ELISA Kit
201-12-0850	SunredBio	96 tests	EUR 440
This procollagen C peptidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Dipeptidyl-Peptidase 4,DPP4 ELISA Kit
201-12-2186	SunredBio	96 tests	EUR 440
This Dipeptidyl-Peptidase 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Tripeptidyl Peptidase I (TPP1)ELISA Kit
201-12-2521	SunredBio	96 tests	EUR 440
This Tripeptidyl Peptidase I ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
DLR-PI16-Hu-48T	DL Develop	48T	EUR 554
Should the Human Peptidase Inhibitor 16 (PI16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peptidase Inhibitor 16 (PI16) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
DLR-PI16-Hu-96T	DL Develop	96T	EUR 725
Should the Human Peptidase Inhibitor 16 (PI16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peptidase Inhibitor 16 (PI16) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
DLR-DPP10-Hu-48T	DL Develop	48T	EUR 517
Should the Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 10 (DPP10) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
DLR-DPP10-Hu-96T	DL Develop	96T	EUR 673
Should the Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 10 (DPP10) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
DLR-DPP4-Hu-48T	DL Develop	48T	EUR 479
Should the Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase IV (DPP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
DLR-DPP4-Hu-96T	DL Develop	96T	EUR 621
Should the Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase IV (DPP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
DLR-DPP6-Hu-48T	DL Develop	48T	EUR 517
Should the Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 6 (DPP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
DLR-DPP6-Hu-96T	DL Develop	96T	EUR 673
Should the Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 6 (DPP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
DLR-DPP8-Hu-48T	DL Develop	48T	EUR 517
Should the Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 8 (DPP8) in samples from tissue homogenates or other biological fluids.

Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
DLR-DPP8-Hu-96T	DL Develop	96T	EUR 673
Should the Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidyl Peptidase 8 (DPP8) in samples from tissue homogenates or other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
DLR-TPP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
DLR-TPP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
DLR-TPP2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Tripeptidyl-Peptidase 2 (TPP2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
DLR-TPP2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Tripeptidyl-Peptidase 2 (TPP2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human dipeptidyl peptidase â…£, DPPâ…£ ELISA Kit
CSB-E08518h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human dipeptidyl peptidase â…£, DPPâ…£ in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human dipeptidyl peptidase â…£, DPPâ…£ ELISA Kit
1-CSB-E08518h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human dipeptidyl peptidase â…£, DPPâ…£ in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human dipeptidyl peptidase  Ⅳ,DPPⅣ ELISA Kit
CSB-E08518h-96T	Cusabio	96T	Ask for price
Sample Volume: 50-100ul Detection Wavelength: 450 nm Research Area: Immunology Assay Principle: quantitative Measurement: Sandwich
Description: DPPⅣ ELISA Kit for detection of human samples. No significant cross-reactivity or interference between human ANPEPand analogues was observed.

Human Peptidase inhibitor 16(PI16) ELISA kit
CSB-EL017951HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Peptidase inhibitor 16 (PI16) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Peptidase inhibitor 16(PI16) ELISA kit
1-CSB-EL017951HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Peptidase inhibitor 16(PI16) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tripeptidyl-peptidase 1(TPP1) ELISA kit
CSB-EL024113HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tripeptidyl-peptidase 1 (TPP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tripeptidyl-peptidase 1(TPP1) ELISA kit
1-CSB-EL024113HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tripeptidyl-peptidase 1(TPP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human procollagen C peptidase,PCP ELISA Kit
CN-04587H1	ChemNorm	96T	EUR 439

Human procollagen C peptidase,PCP ELISA Kit
CN-04587H2	ChemNorm	48T	EUR 290

ELISA kit for Human DPP4 (Dipeptidyl Peptidase ?)
E-EL-H0058	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's DPP4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DPP4. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DPP4 (Dipeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human DPP10 (Dipeptidyl Peptidase ?)
E-EL-H0358	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's DPP10 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DPP10. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DPP10 (Dipeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human TPP1 (Tripeptidyl Peptidase ?)
E-EL-H1479	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's TPP1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TPP1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TPP1 (Tripeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant

Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
SEA884Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase IV (DPP4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase IV (DPP4) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
SEA884Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase IV (DPP4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase IV (DPP4) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
SEA884Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase IV (DPP4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase IV (DPP4) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
SEA884Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidyl Peptidase IV (DPP4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidyl Peptidase IV (DPP4) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
4-SEA884Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Dipeptidyl Peptidase IV elisa. Alternative names of the recognized antigen: CD26 ADA DPPIV DPP-IV ADABP ADCP2 TP103 Adenosine Deaminase Complexing Protein 2 T-cell activation antigen CD26
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidyl Peptidase IV (DPP4) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
4-SEC828Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Tripeptidyl Peptidase I elisa. Alternative names of the recognized antigen: CLN2 GIG1 LPIC Tripeptidyl aminopeptidase Lysosomal pepstatin-insensitive protease Ceroid-Lipofuscinosis, Neuronal 2, Late Infantile Cell growth-inhibitin Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RDR-TPP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RDR-TPP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
RDR-TPP2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
RDR-TPP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Dipeptidyl Peptidase IV ELISA Kit (DPP4)
RK01278	Abclonal	96 Tests	EUR 521

Human Dipeptidyl Peptidase 7 ELISA Kit (DPP7)
RK01279	Abclonal	96 Tests	EUR 521

Human Peptidase Inhibitor 16 ELISA Kit (PI16)
RK02071	Abclonal	96 Tests	EUR 521

Human Tripeptidyl Peptidase I ELISA Kit (TPP1)
RK02437	Abclonal	96 Tests	EUR 521

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
RD-PI16-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
RD-PI16-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
RDR-DPP10-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
RDR-DPP10-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
RDR-DPP4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
RDR-DPP4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
RDR-DPP6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
RDR-DPP6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
RDR-DPP8-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Dipeptidyl Peptidase 8 (DPP8) ELISA Kit
RDR-DPP8-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RD-TPP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RD-TPP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
RD-TPP2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
RD-TPP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
RDR-PI16-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Peptidase Inhibitor 16 (PI16) ELISA Kit
RDR-PI16-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
RD-DPP10-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Dipeptidyl Peptidase 10 (DPP10) ELISA Kit
RD-DPP10-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
RD-DPP4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Dipeptidyl Peptidase IV (DPP4) ELISA Kit
RD-DPP4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
RD-DPP6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Dipeptidyl Peptidase 6 (DPP6) ELISA Kit
RD-DPP6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human PEPD(Peptidase D) ELISA Kit