Human TLL1(Tolloid Like Protein 1) ELISA Kit

Human TLL1(Tolloid Like Protein 1) ELISA Kit

To Order Contact us:

Human Tolloid Like Protein 1 (TLL1) ELISA Kit

RD-TLL1-Hu-96Tests 96 Tests
EUR 783

Human Tolloid Like Protein 1 (TLL1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tolloid- like protein 1, TLL1 ELISA KIT

ELI-17309h 96 Tests
EUR 824

Human Tolloid Like Protein 1(TLL1)ELISA Kit

QY-E04536 96T
EUR 361

Human Tolloid Like Protein 1 ELISA Kit (TLL1)

RK02394 96 Tests
EUR 521

Human Tolloid Like Protein 1 (TLL1) ELISA Kit

SEM373Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Tolloid Like Protein 1 (TLL1) ELISA Kit

SEM373Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Tolloid Like Protein 1 (TLL1) ELISA Kit

SEM373Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Tolloid Like Protein 1 (TLL1) ELISA Kit

SEM373Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Tolloid Like Protein 1 (TLL1) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tolloid Like Protein 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tolloid Like Protein 1 (TLL1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Tolloid Like Protein 1 (TLL1) Protein

  • EUR 815.00
  • EUR 314.00
  • EUR 2611.00
  • EUR 982.00
  • EUR 578.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Tolloid-Like Protein 1 (TLL1) Antibody

abx025889-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tolloid-Like Protein 1 (TLL1) Antibody

abx025889-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tolloid Like Protein 1 (TLL1) Antibody

  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tolloid Like Protein 1 (TLL1) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tolloid-Like Protein 1 (TLL1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chicken Tolloid- like protein 1, TLL1 ELISA KIT

ELI-16872c 96 Tests
EUR 928

Mouse Tolloid Like Protein 1 (TLL1) ELISA Kit

abx390751-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Tolloid- like protein 1, Tll1 ELISA KIT

ELI-41939m 96 Tests
EUR 865

Human Tolloid Like Protein 1 (TLL1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human TLL1 (Tolloid Like Protein 1)

ELK6389 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tolloid Like Protein 1 (TLL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Toll
  • Show more
Description: A sandwich ELISA kit for detection of Tolloid Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Tolloid-Like Protein 1 (TLL1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tolloid-Like Protein 1 (TLL1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tolloid-Like Protein 1 (TLL1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Chicken Tolloid-like protein 1 (TLL1)

KTE30019-48T 48T
EUR 354
  • TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Tolloid-like protein 1 (TLL1)

KTE30019-5platesof96wells 5 plates of 96 wells
EUR 2252
  • TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Tolloid-like protein 1 (TLL1)

KTE30019-96T 96T
EUR 572
  • TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tolloid-like protein 1 (TLL1)

KTE70215-48T 48T
EUR 332
  • TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tolloid-like protein 1 (TLL1)

KTE70215-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tolloid-like protein 1 (TLL1)

KTE70215-96T 96T
EUR 539
  • TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tll1 ELISA Kit| Mouse Tolloid-like protein 1 ELISA Kit

EF016394 96 Tests
EUR 689

TLL1 ELISA Kit| chicken Tolloid-like protein 1 ELISA Kit

EF012540 96 Tests
EUR 689

Human Tolloid Like Protein 1 ELISA kit

E01T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tolloid Like Protein 1 ELISA kit

E01T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tolloid Like Protein 1 ELISA kit

E01T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tolloid Like Protein 1 ELISA kit

E02T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tolloid Like Protein 1 ELISA kit

E02T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tolloid Like Protein 1 ELISA kit

E02T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tolloid Like Protein 1 ELISA kit

E04T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tolloid Like Protein 1 ELISA kit

E04T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tolloid Like Protein 1 ELISA kit

E04T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tolloid Like Protein 1 ELISA kit

E03T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tolloid Like Protein 1 ELISA kit

E03T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tolloid Like Protein 1 ELISA kit

E03T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tolloid Like Protein 1 ELISA kit

E08T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tolloid Like Protein 1 ELISA kit

E08T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tolloid Like Protein 1 ELISA kit

E08T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tolloid Like Protein 1 ELISA kit

E07T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tolloid Like Protein 1 ELISA kit

E07T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tolloid Like Protein 1 ELISA kit

E07T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tolloid Like Protein 1 ELISA kit

E09T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tolloid Like Protein 1 ELISA kit

E09T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tolloid Like Protein 1 ELISA kit

E09T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tolloid Like Protein 1 ELISA kit

E06T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tolloid Like Protein 1 ELISA kit

E06T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tolloid Like Protein 1 ELISA kit

E06T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Guinea pig Tolloid Like Protein 1 ELISA kit

E05T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Tolloid Like Protein 1 ELISA kit

E05T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Tolloid Like Protein 1 ELISA kit

E05T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tolloid- like protein 2, TLL2 ELISA KIT

ELI-16216h 96 Tests
EUR 824

Human Tolloid Like Protein 2 (TLL2) ELISA Kit

abx385476-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Neuropilin and tolloid- like protein 1, NETO1 ELISA KIT

ELI-23195h 96 Tests
EUR 824

Human Neuropilin and tolloid-like 1 (NETO1) ELISA Kit

abx385216-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human Tolloid-like protein 2 (TLL2)

KTE60319-48T 48T
EUR 332
  • TLL2 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin.TLL2 shares 80.3% amino acid se
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tolloid-like protein 2 (TLL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tolloid-like protein 2 (TLL2)

KTE60319-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TLL2 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin.TLL2 shares 80.3% amino acid se
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tolloid-like protein 2 (TLL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tolloid-like protein 2 (TLL2)

KTE60319-96T 96T
EUR 539
  • TLL2 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin.TLL2 shares 80.3% amino acid se
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tolloid-like protein 2 (TLL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Recombinant human Neuropilin and tolloid-like protein 1

P2693 100ug Ask for price
  • Uniprot ID: Q8TDF5
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Neuropilin and tolloid-like protein 1

Mouse Tolloid- like protein 2, Tll2 ELISA KIT

ELI-16873m 96 Tests
EUR 865

Mouse Tolloid Like Protein 2 (TLL2) ELISA Kit

abx390752-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Neuropilin and tolloid- like protein 1, Neto1 ELISA KIT

ELI-23611m 96 Tests
EUR 865

Human TLL1 ELISA Kit

EHT0567 96Tests
EUR 521


EF005652 96 Tests
EUR 689

Mouse Neuropilin and tolloid-like 1 (NETO1) ELISA Kit

abx390035-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Tll2 ELISA Kit| Mouse Tolloid-like protein 2 ELISA Kit

EF016395 96 Tests
EUR 689

Human Neuropilin and tolloid- like protein 2, NETO2 ELISA KIT

ELI-16459h 96 Tests
EUR 824

Neto1 ELISA Kit| Mouse Neuropilin and tolloid-like protein 1 EL

EF015674 96 Tests
EUR 689

Tolloid-Like Protein 2 (TLL2) Antibody

abx122418-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Neuropilin And Tolloid-Like 1 (NETO1) Antibody

abx019143-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Neuropilin and tolloid-like 1 (NETO1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TLL1 ELISA Kit (Human) (OKAN06500)

OKAN06500 96 Wells
EUR 792
Description: Description of target: This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.216 ng/mL

TLL1 ELISA Kit (Human) (OKCD02072)

OKCD02072 96 Wells
EUR 909
Description: Description of target: Protease which processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Required for the embryonic development. Predominant protease, which in the development, influences dorsal-ventral patterning and skeletogenesis. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.216 ng/mL

Mouse Neuropilin and tolloid- like protein 2, Neto2 ELISA KIT

ELI-44722m 96 Tests
EUR 865

Bovine TLL1 ELISA Kit

EBT0567 96Tests
EUR 521

Anserini TLL1 ELISA Kit

EAT0567 96Tests
EUR 521

Chicken TLL1 ELISA Kit

ECKT0567 96Tests
EUR 521

Canine TLL1 ELISA Kit

ECT0567 96Tests
EUR 521


EGTT0567 96Tests
EUR 521

Sheep TLL1 ELISA Kit

EST0567 96Tests
EUR 521

Porcine TLL1 ELISA Kit

EPT0567 96Tests
EUR 521


ERT0567 96Tests
EUR 521

Rabbit TLL1 ELISA Kit

ERTT0567 96Tests
EUR 521

Monkey TLL1 ELISA Kit

EMKT0567 96Tests
EUR 521

Mouse TLL1 ELISA Kit

EMT0567 96Tests
EUR 521

Neuropilin and tolloid-like 1 (NETO1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin and tolloid-like 1 (NETO1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin and tolloid-like 1 (NETO1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guinea Pig TLL1 ELISA Kit

EGT0567 96Tests
EUR 521

Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit

EI1001-1 96 Well Plate
EUR 477

Neuropilin And Tolloid Like 2 (NETO2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody

abx235666-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

TLL1 antibody

31916-100ul 100ul
EUR 252

TLL1 antibody

31916-50ul 50ul
EUR 187

TLL1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLL1. Recognizes TLL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA15055 50 ul
EUR 363
Description: Mouse polyclonal to TLL1


YF-PA15056 50 ug
EUR 363
Description: Mouse polyclonal to TLL1

VSNL1 Visinin-Like Protein-1 Human Recombinant Protein

PROTP62760-1 Regular: 50ug
EUR 317
Description: VSNL1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 191 amino acids (1-191 a.a.) and having a molecular mass of 22.1kDa.;The VSNL1 is purified by proprietary chromatographic techniques.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Human TLL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Neuropilin (Nrp) And Tolloid (Tll)-Like 2 Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

DLK1 Human, Delta-Like 1 Human Recombinant Protein, HEK

PROTP80370-1 Regular: 10ug
EUR 317
Description: DLK1 Human Recombinant produced in HEK293 Cells is a single, glycosylated, polypeptide chain (a.a 24-303) containing 290 amino acids including a 10 a.a C-terminal His tag. The total molecular mass is 31.2kDa (calculated). 

FSTL1 Human, Follistatin Like 1 Human Recombinant Protein, HEK

PROTQ12841-1 Regular: 10ug
EUR 317
Description: FSTL1 Human Recombinant produced in HEK293 cells is a single, glycosylated polypeptide chain (a.a 21-308) containing 296 amino acids including a 8 a.a C-terminal His tag. The total molecular mass is 33.8kDa (calculated).

IL1RL1 Human, Interleukin-1 Receptor Like-1 Human Recombinant Protein, Sf9

PROTQ01638-1 Regular: 10ug
EUR 317
Description: IL 1RL1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (19-328 a.a.) and fused to an 8 aa His Tag at C-terminus containing a total of 318 amino acids and having a molecular mass of 36.0kDa.;IL 1RL1 shows multiple bands between 40-57kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit

EMI1001-1 96 Well Plate
EUR 477

TLL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2379302 1.0 ug DNA
EUR 154

GLP-1 Glucagon Like Peptide-1 (31 a.a.) Human Recombinant Protein

PROTP01275-1 Regular: 50ug
EUR 317
Description: Glucagon Like Peptide-1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 31 amino acids and having a molecular mass of 3298.7 Dalton. The GLP-1 is purified by proprietary chromatographic techniques.

TLL1 cloning plasmid

CSB-CL023595HU-10ug 10ug
EUR 440
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1179
  • Sequence: atggggttgggaacgctttccccgaggatgctcgtgtggctggtggcctcggggattgttttctacggggagctatgggtctgcgctggcctcgattatgattacacttttgatgggaacgaagaggataaaacagagactatagattacaaggacccgtgtaaagccgctgtat
  • Show more
Description: A cloning plasmid for the TLL1 gene.

TINAGL1 Human, Tubulointerstitial Nephritis Antigen Like 1 Human Recombinant Protein, Sf9

PROTQ9GZM7-1 Regular: 5ug
EUR 317
Description: TINAGL1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 455 amino acids (22-467a.a.) and having a molecular mass of 51.2kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). TINAGL1 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Anti-Vangl1/Vang Like Protein 1 Antibody

A07587-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Vangl1 Antibody (VANGL1) detection. Tested with WB in Human, Mouse.

Anti-Visinin-like Protein 1 Monoclonal Antibody

M06959-1 100ul
EUR 397
Description: Mouse Monoclonal Visinin-like Protein 1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

TLL1 ORF Vector (Human) (pORF)

ORF033951 1.0 ug DNA
EUR 405

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

TLL1 Protein Vector (Human) (pPB-C-His)

PV135802 500 ng
EUR 811

TLL1 Protein Vector (Human) (pPB-N-His)

PV135803 500 ng
EUR 811

TLL1 Protein Vector (Human) (pPM-C-HA)

PV135804 500 ng
EUR 811

TLL1 Protein Vector (Human) (pPM-C-His)

PV135805 500 ng
EUR 811

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

EK2802-1 96 Well Plate
EUR 477

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Human Fibrinogen Like Protein 1 ELISA kit

E01F0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fibrinogen Like Protein 1 ELISA kit

E01F0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fibrinogen Like Protein 1 ELISA kit

E01F0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Follistatin Like Protein 1 ELISA kit

E01F0385-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Follistatin Like Protein 1 ELISA kit

E01F0385-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Follistatin Like Protein 1 ELISA kit

E01F0385-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiopoietin Like Protein 1 ELISA kit

E01A0504-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiopoietin Like Protein 1 ELISA kit

E01A0504-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiopoietin Like Protein 1 ELISA kit

E01A0504-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit

EH5215-1 96 Well Plate
EUR 417

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

IGF1 Des1-3 Insulin-Like Growth Factor 1 Des (1-3) Human Recombinant Protein

PROTP01343-1 Regular: 100ug
EUR 317
Description: IGF-I Des(1-3) Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 67 amino acids (aa 4-70) and having a molecular mass of 7368.5 Dalton. ;IGF-1 Des1-3 is purified by proprietary chromatographic techniques.

Mouse TLL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TLL1 Polyclonal Conjugated Antibody

C31916 100ul
EUR 397

TLL1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLL1. Recognizes TLL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TLL1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLL1. Recognizes TLL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TLL1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLL1. Recognizes TLL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

BCL2L2 BCL2 Like 2 Human Recombinant Protein

PROTQ92843-1 Regular: 20ug
EUR 317
Description: Recombinant Human BCL2L2 produced in E.coli cells is a non-glycosylated, homodimeric protein containing 171 amino acid chain and having a molecular mass of 18.6kDa. The Human BCL2L2 is purified by proprietary chromatographic techniques.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

ANGPTL4 Human, Angiopoietin-like Protein 4 Human Recombinant Protein, HEK

PROTQ9BY76-1 Regular: 10ug
EUR 317
Description: The ANGPTL4 Human Recombinant is manufactured with C-terminal fusion of 11 amino acid FLAG Tag. ;The ANGPTL4 Flag -Tagged Fusion Protein is a 44.2kDa protein containing 392 amino acid residues of the Angiopoietin-like Protein 4 and 11 additional amino acid residues - Flag Tag (underlined).

ANGPTL3 Human, Angiopoietin Like Protein 3 Human Recombinant Protein, HEK

PROTQ9Y5C1-1 Regular: 10ug
EUR 317
Description: ANGPTL3 Human Recombinant produced in HEK cells is a single, glycosylated, polypeptide chain (a.a 17-460) containing a total of 450 amino acids, having a molecular mass of 52.6kDa (calculated) and fused to a 6 aa His tag at C-Terminus.;The Human ANGPTL3 is purified by proprietary chromatographic techniques.

Tll1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6534202 1.0 ug DNA
EUR 154

Tll1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3396102 1.0 ug DNA
EUR 154

TLL1 sgRNA CRISPR Lentivector set (Human)

K2379301 3 x 1.0 ug
EUR 339

Human Interleukin 1 Receptor Like Protein 1 ELISA kit

E01I0766-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Interleukin 1 Receptor Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 1 Receptor Like Protein 1 ELISA kit

E01I0766-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Interleukin 1 Receptor Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 1 Receptor Like Protein 1 ELISA kit

E01I0766-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Interleukin 1 Receptor Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beclin- 1- like protein 1, BECN1L1 ELISA KIT

ELI-24481h 96 Tests
EUR 824

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit

EI1770-1 96 Well Plate
EUR 477

Human NEDD4 Family-Interacting Protein 1 (NDFIP1) AssayMax ELISA Kit

EN2550-1 96 Well Plate
EUR 477

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

CD5L Human, CD5 Molecule-Like Human Recombinant Protein, HEK

PROTO43866-1 Regular: 10ug
EUR 317
Description: CD5L Human Recombinant produced in HEK cells is a single, glycosylated, polypeptide chain (Ser20-Gly347) containing a total of 334 amino acids, having a calculated molecular mass of 36.9kDa and fused to a 6 aa His tag at C-Terminus.

Anti-LPCAT2/Acyltransferase Like 1 Antibody

A07471-1 100ul
EUR 397
Description: Rabbit Polyclonal LPCAT2/Acyltransferase Like 1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Glucagon-Like Peptide 2 (GLP-2) AssayMax ELISA Kit

ERG3771-1 96 Well Plate
EUR 477

Human Follistatin Like Protein 1 (FSTL1)ELISA Kit

201-12-2703 96 tests
EUR 440
  • This Follistatin Like Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Leprecan Like Protein 1 (LEPREL1)ELISA Kit

201-12-2787 96 tests
EUR 440
  • This Leprecan Like Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Coactosin Like Protein 1 (COTL1)ELISA Kit

201-12-2904 96 tests
EUR 440
  • This Coactosin Like Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Angiopoietin Like Protein 1 (ANGPTL1) ELISA Kit

EUR 479
  • Should the Human Angiopoietin Like Protein 1 (ANGPTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiopoietin Like Protein 1 (ANGPTL1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Angiopoietin Like Protein 1 (ANGPTL1) ELISA Kit

EUR 621
  • Should the Human Angiopoietin Like Protein 1 (ANGPTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiopoietin Like Protein 1 (ANGPTL1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit

EUR 517
  • Should the Human Chordin Like Protein 1 (CHRDL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chordin Like Protein 1 (CHRDL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit

EUR 673
  • Should the Human Chordin Like Protein 1 (CHRDL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chordin Like Protein 1 (CHRDL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Coactosin Like Protein 1 (COTL1) ELISA Kit

DLR-COTL1-Hu-48T 48T
EUR 517
  • Should the Human Coactosin Like Protein 1 (COTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coactosin Like Protein 1 (COTL1) in samples from tissue homogenates or other biological fluids.

Human Coactosin Like Protein 1 (COTL1) ELISA Kit

DLR-COTL1-Hu-96T 96T
EUR 673
  • Should the Human Coactosin Like Protein 1 (COTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coactosin Like Protein 1 (COTL1) in samples from tissue homogenates or other biological fluids.

Human SPARC Like Protein 1 (SPARCL1) ELISA Kit

EUR 390
  • Should the Human SPARC Like Protein 1 (SPARCL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human SPARC Like Protein 1 (SPARCL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human SPARC Like Protein 1 (SPARCL1) ELISA Kit

EUR 499
  • Should the Human SPARC Like Protein 1 (SPARCL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human SPARC Like Protein 1 (SPARCL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

DLR-TKTL1-Hu-48T 48T
EUR 517
  • Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

DLR-TKTL1-Hu-96T 96T
EUR 673
  • Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit

EUR 517
  • Should the Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leprecan Like Protein 1 (LEPREL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit

EUR 673
  • Should the Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leprecan Like Protein 1 (LEPREL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Delta Like Protein 1 (dLL1) ELISA Kit

DLR-dLL1-Hu-48T 48T
EUR 517
  • Should the Human Delta Like Protein 1 (dLL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Delta Like Protein 1 (dLL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Delta Like Protein 1 (dLL1) ELISA Kit

DLR-dLL1-Hu-96T 96T
EUR 673
  • Should the Human Delta Like Protein 1 (dLL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Delta Like Protein 1 (dLL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human ELAV Like Protein 1 (ELAVL1) ELISA Kit

EUR 517
  • Should the Human ELAV Like Protein 1 (ELAVL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ELAV Like Protein 1 (ELAVL1) in samples from tissue homogenates or other biological fluids.

Human ELAV Like Protein 1 (ELAVL1) ELISA Kit

EUR 673
  • Should the Human ELAV Like Protein 1 (ELAVL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ELAV Like Protein 1 (ELAVL1) in samples from tissue homogenates or other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

DLR-EXTL1-Hu-48T 48T
EUR 554
  • Should the Human Exostoses Like Protein 1 (EXTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

DLR-EXTL1-Hu-96T 96T
EUR 725
  • Should the Human Exostoses Like Protein 1 (EXTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Fibrinogen Like Protein 1 (FGL1) ELISA Kit

DLR-FGL1-Hu-48T 48T
EUR 517
  • Should the Human Fibrinogen Like Protein 1 (FGL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibrinogen Like Protein 1 (FGL1) in samples from plasma.

Human Fibrinogen Like Protein 1 (FGL1) ELISA Kit

DLR-FGL1-Hu-96T 96T
EUR 673
  • Should the Human Fibrinogen Like Protein 1 (FGL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibrinogen Like Protein 1 (FGL1) in samples from plasma.

Human Follistatin Like Protein 1 (FSTL1) ELISA Kit

DLR-FSTL1-Hu-48T 48T
EUR 517
  • Should the Human Follistatin Like Protein 1 (FSTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Follistatin Like Protein 1 (FSTL1) in samples from serum, plasma or other biological fluids.

Human Follistatin Like Protein 1 (FSTL1) ELISA Kit

DLR-FSTL1-Hu-96T 96T
EUR 673
  • Should the Human Follistatin Like Protein 1 (FSTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Follistatin Like Protein 1 (FSTL1) in samples from serum, plasma or other biological fluids.

Human Visinin Like Protein 1 (VSNL1) ELISA Kit

DLR-VSNL1-Hu-48T 48T
EUR 517
  • Should the Human Visinin Like Protein 1 (VSNL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Visinin Like Protein 1 (VSNL1) in samples from tissue homogenates, cerebrospinal fluid or other biological fluids.

Human Visinin Like Protein 1 (VSNL1) ELISA Kit

DLR-VSNL1-Hu-96T 96T
EUR 673
  • Should the Human Visinin Like Protein 1 (VSNL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Visinin Like Protein 1 (VSNL1) in samples from tissue homogenates, cerebrospinal fluid or other biological fluids.

Human AMOTL1/ Angiomotin-like protein 1 ELISA Kit

E0138Hu 1 Kit
EUR 571

Human BolA like protein 1(BOLA1) ELISA kit

E01B0825-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human BolA like protein 1(BOLA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human BolA like protein 1(BOLA1) ELISA kit

E01B0825-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human BolA like protein 1(BOLA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human BolA like protein 1(BOLA1) ELISA kit

E01B0825-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human BolA like protein 1(BOLA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AFG3 like protein 1(AFG3L1) ELISA kit

E01A1304-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human AFG3 like protein 1(AFG3L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AFG3 like protein 1(AFG3L1) ELISA kit

E01A1304-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human AFG3 like protein 1(AFG3L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AFG3 like protein 1(AFG3L1) ELISA kit

E01A1304-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human AFG3 like protein 1(AFG3L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin like protein 1(AMOTL1) ELISA kit

E01A1426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin like protein 1(AMOTL1) ELISA kit

E01A1426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin like protein 1(AMOTL1) ELISA kit

E01A1426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amyloid like protein 1(APLP1) ELISA kit

E01A1594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amyloid like protein 1(APLP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amyloid like protein 1(APLP1) ELISA kit

E01A1594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amyloid like protein 1(APLP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amyloid like protein 1(APLP1) ELISA kit

E01A1594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amyloid like protein 1(APLP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Attractin like protein 1(ATRNL1) ELISA kit

E01A1766-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Attractin like protein 1(ATRNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Attractin like protein 1(ATRNL1) ELISA kit

E01A1766-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Attractin like protein 1(ATRNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Attractin like protein 1(ATRNL1) ELISA kit

E01A1766-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Attractin like protein 1(ATRNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Visinin like protein 1(VSNL1) ELISA kit

E01V0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Visinin like protein 1(VSNL1) ELISA kit

E01V0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Visinin like protein 1(VSNL1) ELISA kit

E01V0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RELT like protein 1(RELL1) ELISA kit

E01R0402-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human RELT like protein 1(RELL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RELT like protein 1(RELL1) ELISA kit

E01R0402-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human RELT like protein 1(RELL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RELT like protein 1(RELL1) ELISA kit

E01R0402-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human RELT like protein 1(RELL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cingulin like protein 1(CGNL1) ELISA kit

E01C1646-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cingulin like protein 1(CGNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cingulin like protein 1(CGNL1) ELISA kit

E01C1646-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cingulin like protein 1(CGNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cingulin like protein 1(CGNL1) ELISA kit

E01C1646-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cingulin like protein 1(CGNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human TLL1(Tolloid Like Protein 1) ELISA Kit

Scroll to Top