Human TLL1(Tolloid Like Protein 1) ELISA Kit

Human TLL1(Tolloid Like Protein 1) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
RD-TLL1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
20-abx153313	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tolloid- like protein 1, TLL1 ELISA KIT
ELI-17309h	Lifescience Market	96 Tests	EUR 824

Human Tolloid Like Protein 1(TLL1)ELISA Kit
QY-E04536	Qayee Biotechnology	96T	EUR 361

Human Tolloid Like Protein 1 ELISA Kit (TLL1)
RK02394	Abclonal	96 Tests	EUR 521

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
SEM373Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
SEM373Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
SEM373Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
SEM373Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
4-SEM373Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Tolloid Like Protein 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tolloid Like Protein 1 (TLL1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Tolloid Like Protein 1 (TLL1) Protein
20-abx655272	Abbexa	EUR 815.00 EUR 314.00 EUR 2611.00 EUR 982.00 EUR 578.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Tolloid-Like Protein 1 (TLL1) Antibody
abx025889-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tolloid-Like Protein 1 (TLL1) Antibody
abx025889-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tolloid Like Protein 1 (TLL1) Antibody
20-abx178636	Abbexa	EUR 1316.00 EUR 620.00	1 mg 200 ug
Please enquire.

Tolloid Like Protein 1 (TLL1) Antibody
20-abx174848	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Tolloid-Like Protein 1 (TLL1) Antibody
20-abx302126	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Chicken Tolloid- like protein 1, TLL1 ELISA KIT
ELI-16872c	Lifescience Market	96 Tests	EUR 928

Mouse Tolloid Like Protein 1 (TLL1) ELISA Kit
abx390751-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Tolloid- like protein 1, Tll1 ELISA KIT
ELI-41939m	Lifescience Market	96 Tests	EUR 865

Human Tolloid Like Protein 1 (TLL1) CLIA Kit
20-abx496053	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human TLL1 (Tolloid Like Protein 1)
ELK6389	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tolloid Like Protein 1 (TLL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Toll Show more
Description: A sandwich ELISA kit for detection of Tolloid Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Tolloid-Like Protein 1 (TLL1) Antibody (HRP)
20-abx314365	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tolloid-Like Protein 1 (TLL1) Antibody (FITC)
20-abx314366	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tolloid-Like Protein 1 (TLL1) Antibody (Biotin)
20-abx314367	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Chicken Tolloid-like protein 1 (TLL1)
KTE30019-48T	Abbkine	48T	EUR 354
TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar Show more
Description: Quantitative sandwich ELISA for measuring Chicken Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Tolloid-like protein 1 (TLL1)
KTE30019-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar Show more
Description: Quantitative sandwich ELISA for measuring Chicken Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Tolloid-like protein 1 (TLL1)
KTE30019-96T	Abbkine	96T	EUR 572
TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar Show more
Description: Quantitative sandwich ELISA for measuring Chicken Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tolloid-like protein 1 (TLL1)
KTE70215-48T	Abbkine	48T	EUR 332
TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tolloid-like protein 1 (TLL1)
KTE70215-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tolloid-like protein 1 (TLL1)
KTE70215-96T	Abbkine	96T	EUR 539
TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tll1 ELISA Kit| Mouse Tolloid-like protein 1 ELISA Kit
EF016394	Lifescience Market	96 Tests	EUR 689

TLL1 ELISA Kit| chicken Tolloid-like protein 1 ELISA Kit
EF012540	Lifescience Market	96 Tests	EUR 689

Human Tolloid Like Protein 1 ELISA kit
E01T0560-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tolloid Like Protein 1 ELISA kit
E01T0560-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tolloid Like Protein 1 ELISA kit
E01T0560-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tolloid Like Protein 1 ELISA kit
E02T0560-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tolloid Like Protein 1 ELISA kit
E02T0560-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tolloid Like Protein 1 ELISA kit
E02T0560-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tolloid Like Protein 1 ELISA kit
E04T0560-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tolloid Like Protein 1 ELISA kit
E04T0560-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tolloid Like Protein 1 ELISA kit
E04T0560-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tolloid Like Protein 1 ELISA kit
E03T0560-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tolloid Like Protein 1 ELISA kit
E03T0560-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tolloid Like Protein 1 ELISA kit
E03T0560-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tolloid Like Protein 1 ELISA kit
E08T0560-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tolloid Like Protein 1 ELISA kit
E08T0560-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tolloid Like Protein 1 ELISA kit
E08T0560-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tolloid Like Protein 1 ELISA kit
E07T0560-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tolloid Like Protein 1 ELISA kit
E07T0560-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tolloid Like Protein 1 ELISA kit
E07T0560-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tolloid Like Protein 1 ELISA kit
E09T0560-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tolloid Like Protein 1 ELISA kit
E09T0560-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tolloid Like Protein 1 ELISA kit
E09T0560-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tolloid Like Protein 1 ELISA kit
E06T0560-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tolloid Like Protein 1 ELISA kit
E06T0560-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tolloid Like Protein 1 ELISA kit
E06T0560-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Guinea pig Tolloid Like Protein 1 ELISA kit
E05T0560-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Tolloid Like Protein 1 ELISA kit
E05T0560-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Tolloid Like Protein 1 ELISA kit
E05T0560-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tolloid- like protein 2, TLL2 ELISA KIT
ELI-16216h	Lifescience Market	96 Tests	EUR 824

Human Tolloid Like Protein 2 (TLL2) ELISA Kit
abx385476-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Neuropilin and tolloid- like protein 1, NETO1 ELISA KIT
ELI-23195h	Lifescience Market	96 Tests	EUR 824

Human Neuropilin and tolloid-like 1 (NETO1) ELISA Kit
abx385216-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Human Tolloid-like protein 2 (TLL2)
KTE60319-48T	Abbkine	48T	EUR 332
TLL2 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin.TLL2 shares 80.3% amino acid se Show more
Description: Quantitative sandwich ELISA for measuring Human Tolloid-like protein 2 (TLL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tolloid-like protein 2 (TLL2)
KTE60319-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
TLL2 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin.TLL2 shares 80.3% amino acid se Show more
Description: Quantitative sandwich ELISA for measuring Human Tolloid-like protein 2 (TLL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tolloid-like protein 2 (TLL2)
KTE60319-96T	Abbkine	96T	EUR 539
TLL2 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin.TLL2 shares 80.3% amino acid se Show more
Description: Quantitative sandwich ELISA for measuring Human Tolloid-like protein 2 (TLL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Recombinant human Neuropilin and tolloid-like protein 1
P2693	FN Test	100ug	Ask for price
Uniprot ID: Q8TDF5 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Neuropilin and tolloid-like protein 1

Mouse Tolloid- like protein 2, Tll2 ELISA KIT
ELI-16873m	Lifescience Market	96 Tests	EUR 865

Mouse Tolloid Like Protein 2 (TLL2) ELISA Kit
abx390752-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Neuropilin and tolloid- like protein 1, Neto1 ELISA KIT
ELI-23611m	Lifescience Market	96 Tests	EUR 865

Human TLL1 ELISA Kit
EHT0567	Abclonal	96Tests	EUR 521

TLL1 ELISA KIT|Human
EF005652	Lifescience Market	96 Tests	EUR 689

Mouse Neuropilin and tolloid-like 1 (NETO1) ELISA Kit
abx390035-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Tll2 ELISA Kit| Mouse Tolloid-like protein 2 ELISA Kit
EF016395	Lifescience Market	96 Tests	EUR 689

Human Neuropilin and tolloid- like protein 2, NETO2 ELISA KIT
ELI-16459h	Lifescience Market	96 Tests	EUR 824

Neto1 ELISA Kit| Mouse Neuropilin and tolloid-like protein 1 EL
EF015674	Lifescience Market	96 Tests	EUR 689

Tolloid-Like Protein 2 (TLL2) Antibody
abx122418-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Neuropilin And Tolloid-Like 1 (NETO1) Antibody
abx019143-100ug	Abbexa	100 ug	EUR 342
Shipped within 5-10 working days.

Neuropilin and tolloid-like 1 (NETO1) Antibody
20-abx338376	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TLL1 ELISA Kit (Human) (OKAN06500)
OKAN06500	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.216 ng/mL

TLL1 ELISA Kit (Human) (OKCD02072)
OKCD02072	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Protease which processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Required for the embryonic development. Predominant protease, which in the development, influences dorsal-ventral patterning and skeletogenesis. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.216 ng/mL

Mouse Neuropilin and tolloid- like protein 2, Neto2 ELISA KIT
ELI-44722m	Lifescience Market	96 Tests	EUR 865

Bovine TLL1 ELISA Kit
EBT0567	Abclonal	96Tests	EUR 521

Anserini TLL1 ELISA Kit
EAT0567	Abclonal	96Tests	EUR 521

Chicken TLL1 ELISA Kit
ECKT0567	Abclonal	96Tests	EUR 521

Canine TLL1 ELISA Kit
ECT0567	Abclonal	96Tests	EUR 521

Goat TLL1 ELISA Kit
EGTT0567	Abclonal	96Tests	EUR 521

Sheep TLL1 ELISA Kit
EST0567	Abclonal	96Tests	EUR 521

Porcine TLL1 ELISA Kit
EPT0567	Abclonal	96Tests	EUR 521

Rat TLL1 ELISA Kit
ERT0567	Abclonal	96Tests	EUR 521

Rabbit TLL1 ELISA Kit
ERTT0567	Abclonal	96Tests	EUR 521

Monkey TLL1 ELISA Kit
EMKT0567	Abclonal	96Tests	EUR 521

Mouse TLL1 ELISA Kit
EMT0567	Abclonal	96Tests	EUR 521

Neuropilin and tolloid-like 1 (NETO1) Antibody (HRP)
20-abx336799	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuropilin and tolloid-like 1 (NETO1) Antibody (FITC)
20-abx336800	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuropilin and tolloid-like 1 (NETO1) Antibody (Biotin)
20-abx336801	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Guinea Pig TLL1 ELISA Kit
EGT0567	Abclonal	96Tests	EUR 521

Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EI1001-1	AssayPro	96 Well Plate	EUR 477

Neuropilin And Tolloid Like 2 (NETO2) Antibody
20-abx217116	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody
20-abx308758	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody
abx235666-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

TLL1 antibody
31916-100ul	SAB	100ul	EUR 252

TLL1 antibody
31916-50ul	SAB	50ul	EUR 187

TLL1 Antibody
1-CSB-PA023595LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLL1. Recognizes TLL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

TLL1 siRNA
20-abx936877	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TLL1 siRNA
20-abx936878	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-TLL1
YF-PA15055	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to TLL1

anti-TLL1
YF-PA15056	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TLL1

VSNL1 Visinin-Like Protein-1 Human Recombinant Protein
PROTP62760-1	BosterBio	Regular: 50ug	EUR 317
Description: VSNL1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 191 amino acids (1-191 a.a.) and having a molecular mass of 22.1kDa.;The VSNL1 is purified by proprietary chromatographic techniques.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Human TLL1 shRNA Plasmid
20-abx954859	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Neuropilin (Nrp) And Tolloid (Tll)-Like 2 Antibody
20-abx114088	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody (HRP)
20-abx308759	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody (FITC)
20-abx308760	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody (Biotin)
20-abx308761	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

DLK1 Human, Delta-Like 1 Human Recombinant Protein, HEK
PROTP80370-1	BosterBio	Regular: 10ug	EUR 317
Description: DLK1 Human Recombinant produced in HEK293 Cells is a single, glycosylated, polypeptide chain (a.a 24-303) containing 290 amino acids including a 10 a.a C-terminal His tag. The total molecular mass is 31.2kDa (calculated).

FSTL1 Human, Follistatin Like 1 Human Recombinant Protein, HEK
PROTQ12841-1	BosterBio	Regular: 10ug	EUR 317
Description: FSTL1 Human Recombinant produced in HEK293 cells is a single, glycosylated polypeptide chain (a.a 21-308) containing 296 amino acids including a 8 a.a C-terminal His tag. The total molecular mass is 33.8kDa (calculated).

IL1RL1 Human, Interleukin-1 Receptor Like-1 Human Recombinant Protein, Sf9
PROTQ01638-1	BosterBio	Regular: 10ug	EUR 317
Description: IL 1RL1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (19-328 a.a.) and fused to an 8 aa His Tag at C-terminus containing a total of 318 amino acids and having a molecular mass of 36.0kDa.;IL 1RL1 shows multiple bands between 40-57kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EMI1001-1	AssayPro	96 Well Plate	EUR 477

TLL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2379302	ABM	1.0 ug DNA	EUR 154

GLP-1 Glucagon Like Peptide-1 (31 a.a.) Human Recombinant Protein
PROTP01275-1	BosterBio	Regular: 50ug	EUR 317
Description: Glucagon Like Peptide-1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 31 amino acids and having a molecular mass of 3298.7 Dalton. The GLP-1 is purified by proprietary chromatographic techniques.

TLL1 cloning plasmid
CSB-CL023595HU-10ug	Cusabio	10ug	EUR 440
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1179 Sequence: atggggttgggaacgctttccccgaggatgctcgtgtggctggtggcctcggggattgttttctacggggagctatgggtctgcgctggcctcgattatgattacacttttgatgggaacgaagaggataaaacagagactatagattacaaggacccgtgtaaagccgctgtat Show more
Description: A cloning plasmid for the TLL1 gene.

TINAGL1 Human, Tubulointerstitial Nephritis Antigen Like 1 Human Recombinant Protein, Sf9
PROTQ9GZM7-1	BosterBio	Regular: 5ug	EUR 317
Description: TINAGL1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 455 amino acids (22-467a.a.) and having a molecular mass of 51.2kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). TINAGL1 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Anti-Vangl1/Vang Like Protein 1 Antibody
A07587-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for Vangl1 Antibody (VANGL1) detection. Tested with WB in Human, Mouse.

Anti-Visinin-like Protein 1 Monoclonal Antibody
M06959-1	BosterBio	100ul	EUR 397
Description: Mouse Monoclonal Visinin-like Protein 1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

TLL1 ORF Vector (Human) (pORF)
ORF033951	ABM	1.0 ug DNA	EUR 405

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

TLL1 Protein Vector (Human) (pPB-C-His)
PV135802	ABM	500 ng	EUR 811

TLL1 Protein Vector (Human) (pPB-N-His)
PV135803	ABM	500 ng	EUR 811

TLL1 Protein Vector (Human) (pPM-C-HA)
PV135804	ABM	500 ng	EUR 811

TLL1 Protein Vector (Human) (pPM-C-His)
PV135805	ABM	500 ng	EUR 811

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Human Fibrinogen Like Protein 1 ELISA kit
E01F0080-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fibrinogen Like Protein 1 ELISA kit
E01F0080-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fibrinogen Like Protein 1 ELISA kit
E01F0080-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Follistatin Like Protein 1 ELISA kit
E01F0385-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Follistatin Like Protein 1 ELISA kit
E01F0385-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Follistatin Like Protein 1 ELISA kit
E01F0385-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiopoietin Like Protein 1 ELISA kit
E01A0504-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiopoietin Like Protein 1 ELISA kit
E01A0504-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiopoietin Like Protein 1 ELISA kit
E01A0504-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit
EH5215-1	AssayPro	96 Well Plate	EUR 417

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

IGF1 Des1-3 Insulin-Like Growth Factor 1 Des (1-3) Human Recombinant Protein
PROTP01343-1	BosterBio	Regular: 100ug	EUR 317
Description: IGF-I Des(1-3) Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 67 amino acids (aa 4-70) and having a molecular mass of 7368.5 Dalton. ;IGF-1 Des1-3 is purified by proprietary chromatographic techniques.

Mouse TLL1 shRNA Plasmid
20-abx973133	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TLL1 Polyclonal Conjugated Antibody
C31916	SAB	100ul	EUR 397

TLL1 Antibody, HRP conjugated
1-CSB-PA023595LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLL1. Recognizes TLL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TLL1 Antibody, FITC conjugated
1-CSB-PA023595LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLL1. Recognizes TLL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TLL1 Antibody, Biotin conjugated
1-CSB-PA023595LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLL1. Recognizes TLL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

BCL2L2 BCL2 Like 2 Human Recombinant Protein
PROTQ92843-1	BosterBio	Regular: 20ug	EUR 317
Description: Recombinant Human BCL2L2 produced in E.coli cells is a non-glycosylated, homodimeric protein containing 171 amino acid chain and having a molecular mass of 18.6kDa. The Human BCL2L2 is purified by proprietary chromatographic techniques.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

ANGPTL4 Human, Angiopoietin-like Protein 4 Human Recombinant Protein, HEK
PROTQ9BY76-1	BosterBio	Regular: 10ug	EUR 317
Description: The ANGPTL4 Human Recombinant is manufactured with C-terminal fusion of 11 amino acid FLAG Tag. ;The ANGPTL4 Flag -Tagged Fusion Protein is a 44.2kDa protein containing 392 amino acid residues of the Angiopoietin-like Protein 4 and 11 additional amino acid residues - Flag Tag (underlined).

ANGPTL3 Human, Angiopoietin Like Protein 3 Human Recombinant Protein, HEK
PROTQ9Y5C1-1	BosterBio	Regular: 10ug	EUR 317
Description: ANGPTL3 Human Recombinant produced in HEK cells is a single, glycosylated, polypeptide chain (a.a 17-460) containing a total of 450 amino acids, having a molecular mass of 52.6kDa (calculated) and fused to a 6 aa His tag at C-Terminus.;The Human ANGPTL3 is purified by proprietary chromatographic techniques.

Tll1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6534202	ABM	1.0 ug DNA	EUR 154

Tll1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3396102	ABM	1.0 ug DNA	EUR 154

TLL1 sgRNA CRISPR Lentivector set (Human)
K2379301	ABM	3 x 1.0 ug	EUR 339

Human Interleukin 1 Receptor Like Protein 1 ELISA kit
E01I0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Interleukin 1 Receptor Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 1 Receptor Like Protein 1 ELISA kit
E01I0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Interleukin 1 Receptor Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 1 Receptor Like Protein 1 ELISA kit
E01I0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Interleukin 1 Receptor Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beclin- 1- like protein 1, BECN1L1 ELISA KIT
ELI-24481h	Lifescience Market	96 Tests	EUR 824

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit
EI1770-1	AssayPro	96 Well Plate	EUR 477

Human NEDD4 Family-Interacting Protein 1 (NDFIP1) AssayMax ELISA Kit
EN2550-1	AssayPro	96 Well Plate	EUR 477

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

CD5L Human, CD5 Molecule-Like Human Recombinant Protein, HEK
PROTO43866-1	BosterBio	Regular: 10ug	EUR 317
Description: CD5L Human Recombinant produced in HEK cells is a single, glycosylated, polypeptide chain (Ser20-Gly347) containing a total of 334 amino acids, having a calculated molecular mass of 36.9kDa and fused to a 6 aa His tag at C-Terminus.

Anti-LPCAT2/Acyltransferase Like 1 Antibody
A07471-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal LPCAT2/Acyltransferase Like 1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Glucagon-Like Peptide 2 (GLP-2) AssayMax ELISA Kit
ERG3771-1	AssayPro	96 Well Plate	EUR 477

Human Follistatin Like Protein 1 (FSTL1)ELISA Kit
201-12-2703	SunredBio	96 tests	EUR 440
This Follistatin Like Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Leprecan Like Protein 1 (LEPREL1)ELISA Kit
201-12-2787	SunredBio	96 tests	EUR 440
This Leprecan Like Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Coactosin Like Protein 1 (COTL1)ELISA Kit
201-12-2904	SunredBio	96 tests	EUR 440
This Coactosin Like Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Angiopoietin Like Protein 1 (ANGPTL1) ELISA Kit
DLR-ANGPTL1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Angiopoietin Like Protein 1 (ANGPTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiopoietin Like Protein 1 (ANGPTL1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Angiopoietin Like Protein 1 (ANGPTL1) ELISA Kit
DLR-ANGPTL1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Angiopoietin Like Protein 1 (ANGPTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiopoietin Like Protein 1 (ANGPTL1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
DLR-CHRDL1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Chordin Like Protein 1 (CHRDL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chordin Like Protein 1 (CHRDL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
DLR-CHRDL1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Chordin Like Protein 1 (CHRDL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chordin Like Protein 1 (CHRDL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Coactosin Like Protein 1 (COTL1) ELISA Kit
DLR-COTL1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Coactosin Like Protein 1 (COTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coactosin Like Protein 1 (COTL1) in samples from tissue homogenates or other biological fluids.

Human Coactosin Like Protein 1 (COTL1) ELISA Kit
DLR-COTL1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Coactosin Like Protein 1 (COTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coactosin Like Protein 1 (COTL1) in samples from tissue homogenates or other biological fluids.

Human SPARC Like Protein 1 (SPARCL1) ELISA Kit
DLR-SPARCL1-Hu-48T	DL Develop	48T	EUR 390
Should the Human SPARC Like Protein 1 (SPARCL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human SPARC Like Protein 1 (SPARCL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human SPARC Like Protein 1 (SPARCL1) ELISA Kit
DLR-SPARCL1-Hu-96T	DL Develop	96T	EUR 499
Should the Human SPARC Like Protein 1 (SPARCL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human SPARC Like Protein 1 (SPARCL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
DLR-TKTL1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
DLR-TKTL1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
DLR-LEPREL1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leprecan Like Protein 1 (LEPREL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
DLR-LEPREL1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leprecan Like Protein 1 (LEPREL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Delta Like Protein 1 (dLL1) ELISA Kit
DLR-dLL1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Delta Like Protein 1 (dLL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Delta Like Protein 1 (dLL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Delta Like Protein 1 (dLL1) ELISA Kit
DLR-dLL1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Delta Like Protein 1 (dLL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Delta Like Protein 1 (dLL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human ELAV Like Protein 1 (ELAVL1) ELISA Kit
DLR-ELAVL1-Hu-48T	DL Develop	48T	EUR 517
Should the Human ELAV Like Protein 1 (ELAVL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ELAV Like Protein 1 (ELAVL1) in samples from tissue homogenates or other biological fluids.

Human ELAV Like Protein 1 (ELAVL1) ELISA Kit
DLR-ELAVL1-Hu-96T	DL Develop	96T	EUR 673
Should the Human ELAV Like Protein 1 (ELAVL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ELAV Like Protein 1 (ELAVL1) in samples from tissue homogenates or other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
DLR-EXTL1-Hu-48T	DL Develop	48T	EUR 554
Should the Human Exostoses Like Protein 1 (EXTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
DLR-EXTL1-Hu-96T	DL Develop	96T	EUR 725
Should the Human Exostoses Like Protein 1 (EXTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Fibrinogen Like Protein 1 (FGL1) ELISA Kit
DLR-FGL1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Fibrinogen Like Protein 1 (FGL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibrinogen Like Protein 1 (FGL1) in samples from plasma.

Human Fibrinogen Like Protein 1 (FGL1) ELISA Kit
DLR-FGL1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Fibrinogen Like Protein 1 (FGL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibrinogen Like Protein 1 (FGL1) in samples from plasma.

Human Follistatin Like Protein 1 (FSTL1) ELISA Kit
DLR-FSTL1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Follistatin Like Protein 1 (FSTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Follistatin Like Protein 1 (FSTL1) in samples from serum, plasma or other biological fluids.

Human Follistatin Like Protein 1 (FSTL1) ELISA Kit
DLR-FSTL1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Follistatin Like Protein 1 (FSTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Follistatin Like Protein 1 (FSTL1) in samples from serum, plasma or other biological fluids.

Human Visinin Like Protein 1 (VSNL1) ELISA Kit
DLR-VSNL1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Visinin Like Protein 1 (VSNL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Visinin Like Protein 1 (VSNL1) in samples from tissue homogenates, cerebrospinal fluid or other biological fluids.

Human Visinin Like Protein 1 (VSNL1) ELISA Kit
DLR-VSNL1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Visinin Like Protein 1 (VSNL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Visinin Like Protein 1 (VSNL1) in samples from tissue homogenates, cerebrospinal fluid or other biological fluids.

Human AMOTL1/ Angiomotin-like protein 1 ELISA Kit
E0138Hu	Sunlong	1 Kit	EUR 571

Human BolA like protein 1(BOLA1) ELISA kit
E01B0825-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human BolA like protein 1(BOLA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human BolA like protein 1(BOLA1) ELISA kit
E01B0825-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human BolA like protein 1(BOLA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human BolA like protein 1(BOLA1) ELISA kit
E01B0825-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human BolA like protein 1(BOLA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AFG3 like protein 1(AFG3L1) ELISA kit
E01A1304-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human AFG3 like protein 1(AFG3L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AFG3 like protein 1(AFG3L1) ELISA kit
E01A1304-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human AFG3 like protein 1(AFG3L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AFG3 like protein 1(AFG3L1) ELISA kit
E01A1304-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human AFG3 like protein 1(AFG3L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin like protein 1(AMOTL1) ELISA kit
E01A1426-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin like protein 1(AMOTL1) ELISA kit
E01A1426-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin like protein 1(AMOTL1) ELISA kit
E01A1426-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amyloid like protein 1(APLP1) ELISA kit
E01A1594-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Amyloid like protein 1(APLP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amyloid like protein 1(APLP1) ELISA kit
E01A1594-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Amyloid like protein 1(APLP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amyloid like protein 1(APLP1) ELISA kit
E01A1594-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Amyloid like protein 1(APLP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Attractin like protein 1(ATRNL1) ELISA kit
E01A1766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Attractin like protein 1(ATRNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Attractin like protein 1(ATRNL1) ELISA kit
E01A1766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Attractin like protein 1(ATRNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Attractin like protein 1(ATRNL1) ELISA kit
E01A1766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Attractin like protein 1(ATRNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Visinin like protein 1(VSNL1) ELISA kit
E01V0076-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Visinin like protein 1(VSNL1) ELISA kit
E01V0076-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Visinin like protein 1(VSNL1) ELISA kit
E01V0076-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RELT like protein 1(RELL1) ELISA kit
E01R0402-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human RELT like protein 1(RELL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RELT like protein 1(RELL1) ELISA kit
E01R0402-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human RELT like protein 1(RELL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RELT like protein 1(RELL1) ELISA kit
E01R0402-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human RELT like protein 1(RELL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cingulin like protein 1(CGNL1) ELISA kit
E01C1646-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cingulin like protein 1(CGNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cingulin like protein 1(CGNL1) ELISA kit
E01C1646-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cingulin like protein 1(CGNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cingulin like protein 1(CGNL1) ELISA kit
E01C1646-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cingulin like protein 1(CGNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human TLL1(Tolloid Like Protein 1) ELISA Kit