Human KRT40(Keratin 40) ELISA Kit

Human KRT40(Keratin 40) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Human Keratin 40 (KRT40) ELISA Kit
RD-KRT40-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Keratin 40 (KRT40) ELISA Kit
RD-KRT40-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Keratin 40 (KRT40) ELISA Kit
20-abx152115	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Keratin 40(KRT40)ELISA Kit
QY-E02823	Qayee Biotechnology	96T	EUR 361

Human Keratin 40 ELISA Kit (KRT40)
RK01748	Abclonal	96 Tests	EUR 521

Human Keratin 40 (KRT40) ELISA Kit
SER654Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Keratin 40 (KRT40) ELISA Kit
SER654Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Keratin 40 (KRT40) ELISA Kit
SER654Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Keratin 40 (KRT40) ELISA Kit
SER654Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Keratin 40 (KRT40) ELISA Kit
4-SER654Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Keratin 40 elisa. Alternative names of the recognized antigen: KA36 CK-40 K40 Cytokeratin-40 Type I hair keratin Ka36
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 40 (KRT40) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Keratin 40 (KRT40) Antibody
20-abx177259	Abbexa	EUR 1316.00 EUR 620.00	1 mg 200 ug
Please enquire.

Keratin 40 (KRT40) Antibody
20-abx173252	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Keratin 40 (KRT40) Antibody
20-abx241238	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Keratin 40 (KRT40) Antibody
20-abx242143	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human Keratin 40 (KRT40) Protein
20-abx654106	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Keratin 40 (KRT40) CLIA Kit
20-abx496227	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human KRT40 (Keratin 40)
ELK6749	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratin 40 (KRT40). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratin 40 (KRT Show more
Description: A sandwich ELISA kit for detection of Keratin 40 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Keratin 40, Type I (KRT40) Antibody
abx234655-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Keratin 40, Type I (KRT40) Antibody
20-abx307557	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Keratin, type I cytoskeletal 40, KRT40 ELISA KIT
ELI-39201h	Lifescience Market	96 Tests	EUR 824

Bovine Keratin, type I cytoskeletal 40, KRT40 ELISA KIT
ELI-14061b	Lifescience Market	96 Tests	EUR 928

Mouse Keratin, type I cytoskeletal 40, Krt40 ELISA KIT
ELI-14062m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human Keratin, type I cytoskeletal 40 (KRT40)
KTE61877-48T	Abbkine	48T	EUR 332
KRT40 encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 40 (KRT40) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type I cytoskeletal 40 (KRT40)
KTE61877-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
KRT40 encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 40 (KRT40) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type I cytoskeletal 40 (KRT40)
KTE61877-96T	Abbkine	96T	EUR 539
KRT40 encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 40 (KRT40) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Keratin 40, Type I (KRT40) Antibody (HRP)
20-abx307558	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Keratin 40, Type I (KRT40) Antibody (FITC)
20-abx307559	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Keratin 40, Type I (KRT40) Antibody (Biotin)
20-abx307560	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Krt40/ Rat Krt40 ELISA Kit
ELI-13584r	Lifescience Market	96 Tests	EUR 886

KRT40 ELISA KIT|Human
EF010593	Lifescience Market	96 Tests	EUR 689

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
DLR-Ab1-40-Hu-48T	DL Develop	48T	EUR 479
Should the Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
DLR-Ab1-40-Hu-96T	DL Develop	96T	EUR 621
Should the Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
RD-Ab1-40-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
RD-Ab1-40-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
RDR-Ab1-40-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
RDR-Ab1-40-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

FUNNEL, 40 MM, PP
6120P-40	CORNING	24/pk	EUR 44
Description: Reusable Plastics; Reusable Funnels

DiagNano Gold Nanoparticle Passive Conjugation Kit, 40 nm
GPK-40	Creative Diagnostics	1 kit	EUR 715

KRT40 ELISA Kit (Human) (OKAN06471)
OKAN06471	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL

KRT40 ELISA Kit (Human) (OKCD09477)
OKCD09477	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

KRT40 ELISA Kit (Human) (OKDD00364)
OKDD00364	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.064 ng/mL

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
DLR-Ab1-40-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
DLR-Ab1-40-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
DLR-Ab1-40-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
DLR-Ab1-40-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
RD-Ab1-40-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
RD-Ab1-40-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
RD-Ab1-40-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
RD-Ab1-40-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
RDR-Ab1-40-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
RDR-Ab1-40-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
RDR-Ab1-40-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit
RDR-Ab1-40-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

ExoDNAPS? Circulating and Exosome-associated DNA Extraction Kit (Human Plasma/Serum, 40 reactions)
K1230-40	Biovision		EUR 1061

DiagNano Fluorophore Labeled Gold Nanoparticles, 40 nm
GFL-40	Creative Diagnostics	1 mL	EUR 1053

ExoDNAUC? Circulating and Exosome-associated DNA Extraction Kit (Urine/Cell Media, 40 reactions)
K1231-40	Biovision		EUR 1061

DiagNano Gold Nanoparticle Medium Covalent Conjugation Kit, 40 nm
GCK-M-40	Creative Diagnostics	1 kit	EUR 757

KRT40 Antibody
35629-100ul	SAB	100ul	EUR 252

KRT40 Antibody
1-CSB-PA696577	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT40. Recognizes KRT40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

KRT40 Antibody
1-CSB-PA718197LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KRT40. Recognizes KRT40 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KRT40 Antibody
1-CSB-PA268168	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT40. Recognizes KRT40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

KRT40 siRNA
20-abx902904	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KRT40 siRNA
20-abx922000	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KRT40 siRNA
20-abx922001	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human KRT40 shRNA Plasmid
20-abx964805	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KRT40 Recombinant Protein (Human)
RP040498	ABM	100 ug	Ask for price

CORNING® REUSABLE PHENOLIC GPI 40-400 THREADED SCREW CAP WITH RUBBER LINER
9999-40	CORNING	72/pk	EUR 140
Description: General Apparatus; Stoppers

Human Connexin 40 ELISA kit
E01C0591-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 40 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Connexin 40 ELISA kit
E01C0591-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 40 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Connexin 40 ELISA kit
E01C0591-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 40 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heat Shock Protein 40,HSP-40 ELISA Kit
201-12-1770	SunredBio	96 tests	EUR 440
This Heat Shock Protein 40 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein 40,HSP-40 ELISA Kit
CN-03555H1	ChemNorm	96T	EUR 473

Human Heat Shock Protein 40,HSP-40 ELISA Kit
CN-03555H2	ChemNorm	48T	EUR 323

Human Heat Shock Protein 40(HSP-40)ELISA Kit
GA-E1786HM-48T	GenAsia Biotech	48T	EUR 289

Human Heat Shock Protein 40(HSP-40)ELISA Kit
GA-E1786HM-96T	GenAsia Biotech	96T	EUR 466

Human Heat Shock Protein 40(HSP-40)ELISA Kit
QY-E01789	Qayee Biotechnology	96T	EUR 361

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 550 nm
RCK-40-550	Creative Diagnostics	1 kit	EUR 1043

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 600 nm
RCK-40-600	Creative Diagnostics	1 kit	EUR 1043

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 650 nm
RCK-40-650	Creative Diagnostics	1 kit	EUR 1043

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 700 nm
RCK-40-700	Creative Diagnostics	1 kit	EUR 1043

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 750 nm
RCK-40-750	Creative Diagnostics	1 kit	EUR 1043

KRT40 Conjugated Antibody
C35629	SAB	100ul	EUR 397

KRT40 cloning plasmid
CSB-CL718197HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1296 Sequence: atgacttctgactgctcctccacacactgctctcctgagtcctgtggcacggcttccggttgtgcacctgcctcaagctgctccgtggaaacagcttgtctccccggtacctgtgctacatcccgatgtcagactccaagcttcctatccaggtctcgcgggctgactggttgcc Show more
Description: A cloning plasmid for the KRT40 gene.

KRT40 Polyclonal Antibody
A65190	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

anti- KRT40 antibody
FNab04655	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:200-1:1000 Immunogen: keratin 40 Uniprot ID: Q6A162 Gene ID: 125115 Research Area: Signal Transduction
Description: Antibody raised against KRT40

Anti-KRT40 antibody
PAab04655	Lifescience Market	100 ug	EUR 412

pCMV-SPORT6-KRT40
PVT17763	Lifescience Market	2 ug	EUR 231

ABeta1-40/ Rat ABeta1- 40 ELISA Kit
ELA-E0864r	Lifescience Market	96 Tests	EUR 886

hSP-40/ Rat hSP- 40 ELISA Kit
ELA-E0872r	Lifescience Market	96 Tests	EUR 886

40 bp random library with flanking sequence; DNA aptamer
DAL-N-40	Alpha Diagnostics	100 ug	EUR 408

DiagNano Fluorophore Labeled Gold Nanoparticles, 40 nm, Cellular Uptake
GFL-40-CU	Creative Diagnostics	1mL	EUR 1365

Human Keratin 9 ELISA Kit
ELA-E2283h	Lifescience Market	96 Tests	EUR 824

Human Keratin 8 ELISA Kit
ELA-E2287h	Lifescience Market	96 Tests	EUR 824

Human Keratin 16 ELISA Kit
ELA-E8852h	Lifescience Market	96 Tests	EUR 824

Human Keratin 15 ELISA Kit
ELA-E8853h	Lifescience Market	96 Tests	EUR 824

Human KRT40(Keratin 40) ELISA Kit