Human KRT40(Keratin 40) ELISA Kit

Human KRT40(Keratin 40) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Human Keratin 40 (KRT40) ELISA Kit

RD-KRT40-Hu-48Tests 48 Tests
EUR 563

Human Keratin 40 (KRT40) ELISA Kit

RD-KRT40-Hu-96Tests 96 Tests
EUR 783

Human Keratin 40 (KRT40) ELISA Kit

20-abx152115
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Keratin 40(KRT40)ELISA Kit

QY-E02823 96T
EUR 361

Human Keratin 40 ELISA Kit (KRT40)

RK01748 96 Tests
EUR 521

Human Keratin 40 (KRT40) ELISA Kit

SER654Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Keratin 40 (KRT40) ELISA Kit

SER654Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Keratin 40 (KRT40) ELISA Kit

SER654Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Keratin 40 (KRT40) ELISA Kit

SER654Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Keratin 40 (KRT40) ELISA Kit

4-SER654Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Keratin 40 elisa. Alternative names of the recognized antigen: KA36
  • CK-40
  • K40
  • Cytokeratin-40
  • Type I hair keratin Ka36
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 40 (KRT40) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Keratin 40 (KRT40) Antibody

20-abx177259
  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Keratin 40 (KRT40) Antibody

20-abx173252
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Keratin 40 (KRT40) Antibody

20-abx241238
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 40 (KRT40) Antibody

20-abx242143
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Keratin 40 (KRT40) Protein

20-abx654106
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Keratin 40 (KRT40) CLIA Kit

20-abx496227
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human KRT40 (Keratin 40)

ELK6749 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratin 40 (KRT40). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratin 40 (KRT
  • Show more
Description: A sandwich ELISA kit for detection of Keratin 40 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Keratin, type I cytoskeletal 40, KRT40 ELISA KIT

ELI-39201h 96 Tests
EUR 824

Keratin 40, Type I (KRT40) Antibody

abx234655-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Keratin 40, Type I (KRT40) Antibody

20-abx307557
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bovine Keratin, type I cytoskeletal 40, KRT40 ELISA KIT

ELI-14061b 96 Tests
EUR 928

Mouse Keratin, type I cytoskeletal 40, Krt40 ELISA KIT

ELI-14062m 96 Tests
EUR 865

ELISA kit for Human Keratin, type I cytoskeletal 40 (KRT40)

KTE61877-48T 48T
EUR 332
  • KRT40 encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 40 (KRT40) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type I cytoskeletal 40 (KRT40)

KTE61877-5platesof96wells 5 plates of 96 wells
EUR 2115
  • KRT40 encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 40 (KRT40) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type I cytoskeletal 40 (KRT40)

KTE61877-96T 96T
EUR 539
  • KRT40 encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 40 (KRT40) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Keratin 40, Type I (KRT40) Antibody (HRP)

20-abx307558
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 40, Type I (KRT40) Antibody (FITC)

20-abx307559
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 40, Type I (KRT40) Antibody (Biotin)

20-abx307560
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Krt40/ Rat Krt40 ELISA Kit

ELI-13584r 96 Tests
EUR 886

KRT40 ELISA KIT|Human

EF010593 96 Tests
EUR 689

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

DLR-Ab1-40-Hu-48T 48T
EUR 479
  • Should the Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

DLR-Ab1-40-Hu-96T 96T
EUR 621
  • Should the Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RD-Ab1-40-Hu-48Tests 48 Tests
EUR 478

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RD-Ab1-40-Hu-96Tests 96 Tests
EUR 662

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RDR-Ab1-40-Hu-48Tests 48 Tests
EUR 500

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RDR-Ab1-40-Hu-96Tests 96 Tests
EUR 692

FUNNEL, 40 MM, PP

6120P-40 24/pk
EUR 44
Description: Reusable Plastics; Reusable Funnels

DiagNano Gold Nanoparticle Passive Conjugation Kit, 40 nm

GPK-40 1 kit
EUR 715

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

DLR-Ab1-40-Mu-48T 48T
EUR 489
  • Should the Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

DLR-Ab1-40-Mu-96T 96T
EUR 635
  • Should the Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

DLR-Ab1-40-Ra-48T 48T
EUR 508
  • Should the Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

DLR-Ab1-40-Ra-96T 96T
EUR 661
  • Should the Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RD-Ab1-40-Mu-48Tests 48 Tests
EUR 489

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RD-Ab1-40-Mu-96Tests 96 Tests
EUR 677

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RD-Ab1-40-Ra-48Tests 48 Tests
EUR 511

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RD-Ab1-40-Ra-96Tests 96 Tests
EUR 709

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RDR-Ab1-40-Mu-48Tests 48 Tests
EUR 511

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RDR-Ab1-40-Mu-96Tests 96 Tests
EUR 709

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RDR-Ab1-40-Ra-48Tests 48 Tests
EUR 534

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RDR-Ab1-40-Ra-96Tests 96 Tests
EUR 742

ExoDNAPS? Circulating and Exosome-associated DNA Extraction Kit (Human Plasma/Serum, 40 reactions)

K1230-40
EUR 1061

DiagNano Fluorophore Labeled Gold Nanoparticles, 40 nm

GFL-40 1 mL
EUR 1053

ExoDNAUC? Circulating and Exosome-associated DNA Extraction Kit (Urine/Cell Media, 40 reactions)

K1231-40
EUR 1061

DiagNano Gold Nanoparticle Medium Covalent Conjugation Kit, 40 nm

GCK-M-40 1 kit
EUR 757

KRT40 Antibody

35629-100ul 100ul
EUR 252

KRT40 Antibody

1-CSB-PA696577
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT40. Recognizes KRT40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

KRT40 Antibody

1-CSB-PA718197LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KRT40. Recognizes KRT40 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KRT40 Antibody

1-CSB-PA268168
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT40. Recognizes KRT40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

KRT40 siRNA

20-abx902904
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KRT40 siRNA

20-abx922000
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KRT40 siRNA

20-abx922001
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human KRT40 shRNA Plasmid

20-abx964805
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KRT40 Recombinant Protein (Human)

RP040498 100 ug Ask for price

CORNING® REUSABLE PHENOLIC GPI 40-400 THREADED SCREW CAP WITH RUBBER LINER

9999-40 72/pk
EUR 140
Description: General Apparatus; Stoppers

Human Connexin 40 ELISA kit

E01C0591-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 40 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Connexin 40 ELISA kit

E01C0591-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 40 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Connexin 40 ELISA kit

E01C0591-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 40 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heat Shock Protein 40,HSP-40 ELISA Kit

201-12-1770 96 tests
EUR 440
  • This Heat Shock Protein 40 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein 40,HSP-40 ELISA Kit

CN-03555H1 96T
EUR 473

Human Heat Shock Protein 40,HSP-40 ELISA Kit

CN-03555H2 48T
EUR 323

Human Heat Shock Protein 40(HSP-40)ELISA Kit

GA-E1786HM-48T 48T
EUR 289

Human Heat Shock Protein 40(HSP-40)ELISA Kit

GA-E1786HM-96T 96T
EUR 466

Human Heat Shock Protein 40(HSP-40)ELISA Kit

QY-E01789 96T
EUR 361

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 550 nm

RCK-40-550 1 kit
EUR 1043

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 600 nm

RCK-40-600 1 kit
EUR 1043

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 650 nm

RCK-40-650 1 kit
EUR 1043

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 700 nm

RCK-40-700 1 kit
EUR 1043

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 750 nm

RCK-40-750 1 kit
EUR 1043

ABeta1-40/ Rat ABeta1- 40 ELISA Kit

ELA-E0864r 96 Tests
EUR 886

hSP-40/ Rat hSP- 40 ELISA Kit

ELA-E0872r 96 Tests
EUR 886

KRT40 Conjugated Antibody

C35629 100ul
EUR 397

KRT40 cloning plasmid

CSB-CL718197HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1296
  • Sequence: atgacttctgactgctcctccacacactgctctcctgagtcctgtggcacggcttccggttgtgcacctgcctcaagctgctccgtggaaacagcttgtctccccggtacctgtgctacatcccgatgtcagactccaagcttcctatccaggtctcgcgggctgactggttgcc
  • Show more
Description: A cloning plasmid for the KRT40 gene.

KRT40 Polyclonal Antibody

A65190 100 µg
EUR 570.55
Description: Ask the seller for details

anti- KRT40 antibody

FNab04655 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: keratin 40
  • Uniprot ID: Q6A162
  • Gene ID: 125115
  • Research Area: Signal Transduction
Description: Antibody raised against KRT40

Anti-KRT40 antibody

PAab04655 100 ug
EUR 412

pCMV-SPORT6-KRT40

PVT17763 2 ug
EUR 231

40 bp random library with flanking sequence; DNA aptamer

DAL-N-40 100 ug
EUR 408

DiagNano Fluorophore Labeled Gold Nanoparticles, 40 nm, Cellular Uptake

GFL-40-CU 1mL
EUR 1365

Human Keratin 9 ELISA Kit

ELA-E2283h 96 Tests
EUR 824

Human Keratin 8 ELISA Kit

ELA-E2287h 96 Tests
EUR 824

Human Keratin 16 ELISA Kit

ELA-E8852h 96 Tests
EUR 824

Human Keratin 15 ELISA Kit

ELA-E8853h 96 Tests
EUR 824

Human Keratin 12 ELISA Kit

ELA-E8860h 96 Tests
EUR 824

Human Keratin 19 ELISA Kit

ELA-E9126h 96 Tests
EUR 824

Human Keratin 20 ELISA Kit

ELA-E9127h 96 Tests
EUR 824

Human Keratin 13 ELISA Kit

ELA-E9417h 96 Tests
EUR 824

KRT40 ORF Vector (Human) (pORF)

ORF013500 1.0 ug DNA
EUR 354

DiagNano Gold Nanorods, diameter 40 nm, absorption max 550 nm

BR-40-550 25 mL
EUR 720

DiagNano Gold Nanorods, diameter 40 nm, absorption max 600 nm

BR-40-600 25 mL
EUR 720

DiagNano Gold Nanorods, diameter 40 nm, absorption max 650 nm

BR-40-650 25 mL
EUR 720

DiagNano Gold Nanorods, diameter 40 nm, absorption max 750 nm

BR-40-750 25 mL
EUR 720

DiagNano Gold Nanorods, diameter 40 nm, absorption max 780 nm

BR-40-780 25 mL
EUR 720

DiagNano Gold Nanorods, diameter 40 nm, absorption max 808 nm

BR-40-808 25 mL
EUR 720

DiagNano Gold Nanorods, diameter 40 nm, absorption max 850 nm

BR-40-850 25 mL
EUR 720

ELISA kit for Human HSP-40 (Heat Shock Protein 40)

E-EL-H1861 1 plate of 96 wells
EUR 377
  • Gentaur's HSP-40 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human HSP-40. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human HSP-40 (Heat Shock Protein 40) in samples from Serum, Plasma, Cell supernatant

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

abx053393-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

20-abx150496
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

ED1031-096 96T
EUR 887

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

CEA864Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Amyloid Beta Peptide 1-40 (Ab1-40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in serum, plasma and other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

CEA864Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Amyloid Beta Peptide 1-40 (Ab1-40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in serum, plasma and other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

CEA864Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Amyloid Beta Peptide 1-40 (Ab1-40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in serum, plasma and other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

CEA864Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Amyloid Beta Peptide 1-40 (Ab1-40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in serum, plasma and other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

4-CEA864Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Amyloid Beta Peptide 1-40 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Human amyloid beta peptide 1-40,Aβ1-40 ELISA Kit

CN-03356H1 96T
EUR 454

Human amyloid beta peptide 1-40,Aβ1-40 ELISA Kit

CN-03356H2 48T
EUR 303

Human amyloid beta peptide 1-40(Aβ1-40)ELISA Kit

GA-E1247HM-48T 48T
EUR 289

Human amyloid beta peptide 1-40(Aβ1-40)ELISA Kit

GA-E1247HM-96T 96T
EUR 466

Human amyloid beta peptide 1-40(Aβ1-40)ELISA Kit

QY-E04414 96T
EUR 361

Human Amyloid Beta Peptide 1-40 ELISA Kit (Ab1-40)

RK00784 96 Tests
EUR 521

Human beta-40(Amyloid Beta Peptide 1-40) ELISA Kit

STJ150127 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of Abeta1-40 in human serum, plasma and other biological fluids

DiagNano Anti-Human IgA conjugated Gold Nanorods, diameter 40 nm, absorption max 550 nm

RHA-40-550 1 mL
EUR 1022

DiagNano Anti-Human IgA conjugated Gold Nanorods, diameter 40 nm, absorption max 600 nm

RHA-40-600 1 mL
EUR 1022

DiagNano Anti-Human IgA conjugated Gold Nanorods, diameter 40 nm, absorption max 650 nm

RHA-40-650 1 mL
EUR 1022

DiagNano Anti-Human IgA conjugated Gold Nanorods, diameter 40 nm, absorption max 750 nm

RHA-40-750 1 mL
EUR 1022

DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 550 nm

RHG-40-550 1 mL
EUR 1022

DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 600 nm

RHG-40-600 1 mL
EUR 1022

DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 650 nm

RHG-40-650 1 mL
EUR 1022

DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 700 nm

RHG-40-700 1 mL
EUR 1022

DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 750 nm

RHG-40-750 1 mL
EUR 1022

DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 550 nm

RHM-40-550 1 mL
EUR 1022

DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 600 nm

RHM-40-600 1 mL
EUR 1022

DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 650 nm

RHM-40-650 1 mL
EUR 1022

DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 700 nm

RHM-40-700 1 mL
EUR 1022

DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 750 nm

RHM-40-750 1 mL
EUR 1022

MP (Mycoplasma Pneumoniae Antibody IgG) ELISA test

40 96T/Box Ask for price
  • Area of application: Respiratory tract testing
Description: ELISA based test for quantitative detection of MP (Mycoplasma Pneumoniae Antibody IgG)

Human Connexin 40 (CX40) ELISA Kit

DLR-CX40-Hu-48T 48T
EUR 498
  • Should the Human Connexin 40 (CX40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Connexin 40 (CX40) in samples from tissue homogenates or other biological fluids.

Human Connexin 40 (CX40) ELISA Kit

DLR-CX40-Hu-96T 96T
EUR 647
  • Should the Human Connexin 40 (CX40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Connexin 40 (CX40) in samples from tissue homogenates or other biological fluids.

Human CD 40 Ligand ELISA kit

E01C0018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CD 40 Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD 40 Ligand ELISA kit

E01C0018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CD 40 Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD 40 Ligand ELISA kit

E01C0018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CD 40 Ligand in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CX40(Connexin 40) ELISA Kit

EH2909 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P36382
  • Alias: CX40/ATFB11/GJA5/alpha 5, 40kD(connexin 40)/connexin-40/Connexin-40/Cx40/gap junction alpha-5 protein/gap junction protein, alpha 5, 40kDa/gap junction protein, alpha 5, 40kDa(connexin 40)/MGC
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human amyloid β1-40 ELISA Kit

EHA0917 96Tests
EUR 521

A尾40 ELISA KIT |Human

EF001883 96 Tests
EUR 689

Human Connexin 40(CX40)ELISA Kit

QY-E02877 96T
EUR 361

Human Connexin 40 (CX40) ELISA Kit

RDR-CX40-Hu-48Tests 48 Tests
EUR 522

Human Connexin 40 (CX40) ELISA Kit

RDR-CX40-Hu-96Tests 96 Tests
EUR 724

Human Connexin 40 (CX40) ELISA Kit

SEB465Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Connexin 40 (CX40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Connexin 40 (CX40) in Tissue homogenates and other biological fluids.

Human Connexin 40 (CX40) ELISA Kit

SEB465Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Connexin 40 (CX40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Connexin 40 (CX40) in Tissue homogenates and other biological fluids.

Human Connexin 40 (CX40) ELISA Kit

SEB465Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Connexin 40 (CX40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Connexin 40 (CX40) in Tissue homogenates and other biological fluids.

Human Connexin 40 (CX40) ELISA Kit

SEB465Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Connexin 40 (CX40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Connexin 40 (CX40) in Tissue homogenates and other biological fluids.

Human Connexin 40 (CX40) ELISA Kit

4-SEB465Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Connexin 40 elisa. Alternative names of the recognized antigen: GJA5
  • GJ-A5
  • Gap Junction Protein Alpha 5
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Connexin 40 (CX40) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Connexin 40 (CX40) ELISA Kit

RD-CX40-Hu-48Tests 48 Tests
EUR 500

Human Connexin 40 (CX40) ELISA Kit

RD-CX40-Hu-96Tests 96 Tests
EUR 692

DiagNano Organic Gold Nanorods, diameter 40 nm, absorption max 550 nm

OR-40-550 1 mL
EUR 1022

DiagNano Organic Gold Nanorods, diameter 40 nm, absorption max 600 nm

OR-40-600 1 mL
EUR 1022

Human KRT40(Keratin 40) ELISA Kit

Scroll to Top