Human KRT40(Keratin 40) ELISA Kit

Human KRT40(Keratin 40) ELISA Kit

To Order Contact us:

Human Keratin 40 (KRT40) ELISA Kit

RD-KRT40-Hu-48Tests 48 Tests
EUR 563

Human Keratin 40 (KRT40) ELISA Kit

RD-KRT40-Hu-96Tests 96 Tests
EUR 783

Human Keratin 40 (KRT40) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Keratin 40(KRT40)ELISA Kit

QY-E02823 96T
EUR 361

Human Keratin 40 ELISA Kit (KRT40)

RK01748 96 Tests
EUR 521

Human Keratin 40 (KRT40) ELISA Kit

SER654Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Keratin 40 (KRT40) ELISA Kit

SER654Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Keratin 40 (KRT40) ELISA Kit

SER654Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Keratin 40 (KRT40) ELISA Kit

SER654Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Keratin 40 (KRT40) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Keratin 40 elisa. Alternative names of the recognized antigen: KA36
  • CK-40
  • K40
  • Cytokeratin-40
  • Type I hair keratin Ka36
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 40 (KRT40) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Keratin 40 (KRT40) Antibody

  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Keratin 40 (KRT40) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Keratin 40 (KRT40) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 40 (KRT40) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Keratin 40 (KRT40) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Keratin 40 (KRT40) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human KRT40 (Keratin 40)

ELK6749 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratin 40 (KRT40). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratin 40 (KRT
  • Show more
Description: A sandwich ELISA kit for detection of Keratin 40 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Keratin 40, Type I (KRT40) Antibody

abx234655-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Keratin 40, Type I (KRT40) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Keratin, type I cytoskeletal 40, KRT40 ELISA KIT

ELI-39201h 96 Tests
EUR 824

Bovine Keratin, type I cytoskeletal 40, KRT40 ELISA KIT

ELI-14061b 96 Tests
EUR 928

Mouse Keratin, type I cytoskeletal 40, Krt40 ELISA KIT

ELI-14062m 96 Tests
EUR 865

ELISA kit for Human Keratin, type I cytoskeletal 40 (KRT40)

KTE61877-48T 48T
EUR 332
  • KRT40 encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 40 (KRT40) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type I cytoskeletal 40 (KRT40)

KTE61877-5platesof96wells 5 plates of 96 wells
EUR 2115
  • KRT40 encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 40 (KRT40) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type I cytoskeletal 40 (KRT40)

KTE61877-96T 96T
EUR 539
  • KRT40 encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 40 (KRT40) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Keratin 40, Type I (KRT40) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 40, Type I (KRT40) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 40, Type I (KRT40) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Krt40/ Rat Krt40 ELISA Kit

ELI-13584r 96 Tests
EUR 886


EF010593 96 Tests
EUR 689

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

DLR-Ab1-40-Hu-48T 48T
EUR 479
  • Should the Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

DLR-Ab1-40-Hu-96T 96T
EUR 621
  • Should the Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RD-Ab1-40-Hu-48Tests 48 Tests
EUR 478

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RD-Ab1-40-Hu-96Tests 96 Tests
EUR 662

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RDR-Ab1-40-Hu-48Tests 48 Tests
EUR 500

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RDR-Ab1-40-Hu-96Tests 96 Tests
EUR 692


6120P-40 24/pk
EUR 44
Description: Reusable Plastics; Reusable Funnels

DiagNano Gold Nanoparticle Passive Conjugation Kit, 40 nm

GPK-40 1 kit
EUR 715

KRT40 ELISA Kit (Human) (OKAN06471)

OKAN06471 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL

KRT40 ELISA Kit (Human) (OKCD09477)

OKCD09477 96 Wells
EUR 909
Description: Description of target: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

KRT40 ELISA Kit (Human) (OKDD00364)

OKDD00364 96 Wells
EUR 1053
Description: Description of target: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.064 ng/mL

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

DLR-Ab1-40-Mu-48T 48T
EUR 489
  • Should the Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

DLR-Ab1-40-Mu-96T 96T
EUR 635
  • Should the Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

DLR-Ab1-40-Ra-48T 48T
EUR 508
  • Should the Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

DLR-Ab1-40-Ra-96T 96T
EUR 661
  • Should the Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids.

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RD-Ab1-40-Mu-48Tests 48 Tests
EUR 489

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RD-Ab1-40-Mu-96Tests 96 Tests
EUR 677

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RD-Ab1-40-Ra-48Tests 48 Tests
EUR 511

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RD-Ab1-40-Ra-96Tests 96 Tests
EUR 709

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RDR-Ab1-40-Mu-48Tests 48 Tests
EUR 511

Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RDR-Ab1-40-Mu-96Tests 96 Tests
EUR 709

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RDR-Ab1-40-Ra-48Tests 48 Tests
EUR 534

Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

RDR-Ab1-40-Ra-96Tests 96 Tests
EUR 742

ExoDNAPS? Circulating and Exosome-associated DNA Extraction Kit (Human Plasma/Serum, 40 reactions)

EUR 1061

DiagNano Fluorophore Labeled Gold Nanoparticles, 40 nm

GFL-40 1 mL
EUR 1053

ExoDNAUC? Circulating and Exosome-associated DNA Extraction Kit (Urine/Cell Media, 40 reactions)

EUR 1061

DiagNano Gold Nanoparticle Medium Covalent Conjugation Kit, 40 nm

GCK-M-40 1 kit
EUR 757

KRT40 Antibody

35629-100ul 100ul
EUR 252

KRT40 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT40. Recognizes KRT40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

KRT40 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KRT40. Recognizes KRT40 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KRT40 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT40. Recognizes KRT40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human KRT40 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KRT40 Recombinant Protein (Human)

RP040498 100 ug Ask for price


9999-40 72/pk
EUR 140
Description: General Apparatus; Stoppers

Human Connexin 40 ELISA kit

E01C0591-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 40 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Connexin 40 ELISA kit

E01C0591-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 40 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Connexin 40 ELISA kit

E01C0591-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 40 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heat Shock Protein 40,HSP-40 ELISA Kit

201-12-1770 96 tests
EUR 440
  • This Heat Shock Protein 40 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Heat Shock Protein 40,HSP-40 ELISA Kit

CN-03555H1 96T
EUR 473

Human Heat Shock Protein 40,HSP-40 ELISA Kit

CN-03555H2 48T
EUR 323

Human Heat Shock Protein 40(HSP-40)ELISA Kit

GA-E1786HM-48T 48T
EUR 289

Human Heat Shock Protein 40(HSP-40)ELISA Kit

GA-E1786HM-96T 96T
EUR 466

Human Heat Shock Protein 40(HSP-40)ELISA Kit

QY-E01789 96T
EUR 361

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 550 nm

RCK-40-550 1 kit
EUR 1043

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 600 nm

RCK-40-600 1 kit
EUR 1043

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 650 nm

RCK-40-650 1 kit
EUR 1043

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 700 nm

RCK-40-700 1 kit
EUR 1043

DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 750 nm

RCK-40-750 1 kit
EUR 1043

KRT40 Conjugated Antibody

C35629 100ul
EUR 397

KRT40 cloning plasmid

CSB-CL718197HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1296
  • Sequence: atgacttctgactgctcctccacacactgctctcctgagtcctgtggcacggcttccggttgtgcacctgcctcaagctgctccgtggaaacagcttgtctccccggtacctgtgctacatcccgatgtcagactccaagcttcctatccaggtctcgcgggctgactggttgcc
  • Show more
Description: A cloning plasmid for the KRT40 gene.

KRT40 Polyclonal Antibody

A65190 100 µg
EUR 570.55
Description: Ask the seller for details

anti- KRT40 antibody

FNab04655 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: keratin 40
  • Uniprot ID: Q6A162
  • Gene ID: 125115
  • Research Area: Signal Transduction
Description: Antibody raised against KRT40

Anti-KRT40 antibody

PAab04655 100 ug
EUR 412


PVT17763 2 ug
EUR 231

ABeta1-40/ Rat ABeta1- 40 ELISA Kit

ELA-E0864r 96 Tests
EUR 886

hSP-40/ Rat hSP- 40 ELISA Kit

ELA-E0872r 96 Tests
EUR 886

40 bp random library with flanking sequence; DNA aptamer

DAL-N-40 100 ug
EUR 408

DiagNano Fluorophore Labeled Gold Nanoparticles, 40 nm, Cellular Uptake

GFL-40-CU 1mL
EUR 1365

Human Keratin 9 ELISA Kit

ELA-E2283h 96 Tests
EUR 824

Human Keratin 8 ELISA Kit

ELA-E2287h 96 Tests
EUR 824

Human Keratin 16 ELISA Kit

ELA-E8852h 96 Tests
EUR 824

Human Keratin 15 ELISA Kit

ELA-E8853h 96 Tests
EUR 824

Human Keratin 12 ELISA Kit

ELA-E8860h 96 Tests
EUR 824

Human Keratin 19 ELISA Kit

ELA-E9126h 96 Tests
EUR 824

Human Keratin 20 ELISA Kit

ELA-E9127h 96 Tests
EUR 824

Human Keratin 13 ELISA Kit

ELA-E9417h 96 Tests
EUR 824

KRT40 ORF Vector (Human) (pORF)

ORF013500 1.0 ug DNA
EUR 354

DiagNano Gold Nanorods, diameter 40 nm, absorption max 550 nm

BR-40-550 25 mL
EUR 720

DiagNano Gold Nanorods, diameter 40 nm, absorption max 600 nm

BR-40-600 25 mL
EUR 720

DiagNano Gold Nanorods, diameter 40 nm, absorption max 650 nm

BR-40-650 25 mL
EUR 720

DiagNano Gold Nanorods, diameter 40 nm, absorption max 750 nm

BR-40-750 25 mL
EUR 720

DiagNano Gold Nanorods, diameter 40 nm, absorption max 780 nm

BR-40-780 25 mL
EUR 720

DiagNano Gold Nanorods, diameter 40 nm, absorption max 808 nm

BR-40-808 25 mL
EUR 720

DiagNano Gold Nanorods, diameter 40 nm, absorption max 850 nm

BR-40-850 25 mL
EUR 720

DiagNano Anti-Human IgA conjugated Gold Nanorods, diameter 40 nm, absorption max 550 nm

RHA-40-550 1 mL
EUR 1022

DiagNano Anti-Human IgA conjugated Gold Nanorods, diameter 40 nm, absorption max 600 nm

RHA-40-600 1 mL
EUR 1022

DiagNano Anti-Human IgA conjugated Gold Nanorods, diameter 40 nm, absorption max 650 nm

RHA-40-650 1 mL
EUR 1022

DiagNano Anti-Human IgA conjugated Gold Nanorods, diameter 40 nm, absorption max 750 nm

RHA-40-750 1 mL
EUR 1022

DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 550 nm

RHG-40-550 1 mL
EUR 1022

DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 600 nm

RHG-40-600 1 mL
EUR 1022

DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 650 nm

RHG-40-650 1 mL
EUR 1022

DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 700 nm

RHG-40-700 1 mL
EUR 1022

DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 750 nm

RHG-40-750 1 mL
EUR 1022

DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 550 nm

RHM-40-550 1 mL
EUR 1022

DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 600 nm

RHM-40-600 1 mL
EUR 1022

DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 650 nm

RHM-40-650 1 mL
EUR 1022

DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 700 nm

RHM-40-700 1 mL
EUR 1022

DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 750 nm

RHM-40-750 1 mL
EUR 1022

ELISA kit for Human HSP-40 (Heat Shock Protein 40)

E-EL-H1861 1 plate of 96 wells
EUR 377
  • Gentaur's HSP-40 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human HSP-40. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human HSP-40 (Heat Shock Protein 40) in samples from Serum, Plasma, Cell supernatant

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

abx053393-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

ED1031-096 96T
EUR 887

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

CEA864Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Amyloid Beta Peptide 1-40 (Ab1-40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in serum, plasma and other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

CEA864Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Amyloid Beta Peptide 1-40 (Ab1-40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in serum, plasma and other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

CEA864Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Amyloid Beta Peptide 1-40 (Ab1-40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in serum, plasma and other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

CEA864Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Amyloid Beta Peptide 1-40 (Ab1-40) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in serum, plasma and other biological fluids.

Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Amyloid Beta Peptide 1-40 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Human amyloid beta peptide 1-40,Aβ1-40 ELISA Kit

CN-03356H1 96T
EUR 454

Human amyloid beta peptide 1-40,Aβ1-40 ELISA Kit

CN-03356H2 48T
EUR 303

Human amyloid beta peptide 1-40(Aβ1-40)ELISA Kit

GA-E1247HM-48T 48T
EUR 289

Human amyloid beta peptide 1-40(Aβ1-40)ELISA Kit

GA-E1247HM-96T 96T
EUR 466

Human amyloid beta peptide 1-40(Aβ1-40)ELISA Kit

QY-E04414 96T
EUR 361

Human Amyloid Beta Peptide 1-40 ELISA Kit (Ab1-40)

RK00784 96 Tests
EUR 521

Human beta-40(Amyloid Beta Peptide 1-40) ELISA Kit

STJ150127 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of Abeta1-40 in human serum, plasma and other biological fluids

MP (Mycoplasma Pneumoniae Antibody IgG) ELISA test

40 96T/Box Ask for price
  • Area of application: Respiratory tract testing
Description: ELISA based test for quantitative detection of MP (Mycoplasma Pneumoniae Antibody IgG)

DiagNano Organic Gold Nanorods, diameter 40 nm, absorption max 550 nm

OR-40-550 1 mL
EUR 1022

DiagNano Organic Gold Nanorods, diameter 40 nm, absorption max 600 nm

OR-40-600 1 mL
EUR 1022

DiagNano Organic Gold Nanorods, diameter 40 nm, absorption max 650 nm

OR-40-650 1 mL
EUR 1022

DiagNano Organic Gold Nanorods, diameter 40 nm, absorption max 700 nm

OR-40-700 1 mL
EUR 1022

DiagNano Organic Gold Nanorods, diameter 40 nm, absorption max 750 nm

OR-40-750 1 mL
EUR 1022

DiagNano Amine Gold Nanorods, diameter 40 nm, absorption max 550 nm

RFA-40-550 1 mL
EUR 1022

DiagNano Amine Gold Nanorods, diameter 40 nm, absorption max 650 nm

RFA-40-650 1 mL
EUR 1022

DiagNano Amine Gold Nanorods, diameter 40 nm, absorption max 700 nm

RFA-40-700 1 mL
EUR 1022

DiagNano Amine Gold Nanorods, diameter 40 nm, absorption max 750 nm

RFA-40-750 1 mL
EUR 1022

DiagNano Biotin Gold Nanorods, diameter 40 nm, absorption max 550 nm

RFB-40-550 1 mL
EUR 1022

DiagNano Biotin Gold Nanorods, diameter 40 nm, absorption max 600 nm

RFB-40-600 1 mL
EUR 1022

DiagNano Biotin Gold Nanorods, diameter 40 nm, absorption max 650 nm

RFB-40-650 1 mL
EUR 1022

DiagNano Biotin Gold Nanorods, diameter 40 nm, absorption max 750 nm

RFB-40-750 1 mL
EUR 1022

DiagNano Carboxyl Gold Nanorods, diameter 40 nm, absorption max 550 nm

RFC-40-550 1 mL
EUR 1022

DiagNano Carboxyl Gold Nanorods, diameter 40 nm, absorption max 600 nm

RFC-40-600 1 mL
EUR 1022

DiagNano Carboxyl Gold Nanorods, diameter 40 nm, absorption max 650 nm

RFC-40-650 1 mL
EUR 1022

DiagNano Carboxyl Gold Nanorods, diameter 40 nm, absorption max 700 nm

RFC-40-700 1 mL
EUR 1022

Human KRT40(Keratin 40) ELISA Kit

Scroll to Top