Mouse PPL(Periplakin) ELISA Kit

Mouse PPL(Periplakin) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Mouse Periplakin (PPL) ELISA Kit
RD-PPL-Mu-48Tests 48 Tests
EUR 533
Mouse Periplakin (PPL) ELISA Kit
RD-PPL-Mu-96Tests 96 Tests
EUR 740
Human Periplakin (PPL) ELISA Kit
DLR-PPL-Hu-48T 48T
EUR 517
  • Should the Human Periplakin (PPL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Human Periplakin (PPL) ELISA Kit
DLR-PPL-Hu-96T 96T
EUR 673
  • Should the Human Periplakin (PPL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Human Periplakin (PPL) ELISA Kit
RDR-PPL-Hu-48Tests 48 Tests
EUR 544
Human Periplakin (PPL) ELISA Kit
RDR-PPL-Hu-96Tests 96 Tests
EUR 756
Human Periplakin (PPL) ELISA Kit
RD-PPL-Hu-48Tests 48 Tests
EUR 521
Human Periplakin (PPL) ELISA Kit
RD-PPL-Hu-96Tests 96 Tests
EUR 723
Mouse Periplakin (PPL) ELISA Kit
20-abx154532
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Periplakin, Ppl ELISA KIT
ELI-35659m 96 Tests
EUR 865
Mouse Periplakin(PPL)ELISA Kit
QY-E21728 96T
EUR 374
Mouse Periplakin (PPL) ELISA Kit
SEH334Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Mouse Periplakin (PPL) ELISA Kit
SEH334Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Mouse Periplakin (PPL) ELISA Kit
SEH334Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Mouse Periplakin (PPL) ELISA Kit
SEH334Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Mouse Periplakin (PPL) ELISA Kit
4-SEH334Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Periplakin elisa. Alternative names of the recognized antigen: 190 kDa paraneoplastic pemphigus antigen
  • 195 kDa cornified envelope precursor protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Periplakin (PPL) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
ELISA kit for Mouse PPL (Periplakin)
ELK6363 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Periplakin (PPL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Periplakin (PPL).
  • Show more
Description: A sandwich ELISA kit for detection of Periplakin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse Periplakin (PPL)
KTE70706-48T 48T
EUR 332
  • Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Periplakin (PPL)
KTE70706-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Periplakin (PPL)
KTE70706-96T 96T
EUR 539
  • Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Periplakin (PPL) CLIA Kit
20-abx495435
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Periplakin (PPL) Protein
20-abx167309
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Periplakin (PPL) ELISA Kit
20-abx152709
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Periplakin, PPL ELISA KIT
ELI-15152h 96 Tests
EUR 824
Human Periplakin(PPL)ELISA Kit
QY-E02006 96T
EUR 361
Human Periplakin (PPL) ELISA Kit
SEH334Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Periplakin (PPL) ELISA Kit
SEH334Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Periplakin (PPL) ELISA Kit
SEH334Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Periplakin (PPL) ELISA Kit
SEH334Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Periplakin (PPL) ELISA Kit
4-SEH334Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Periplakin elisa. Alternative names of the recognized antigen: 190 kDa paraneoplastic pemphigus antigen
  • 195 kDa cornified envelope precursor protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Periplakin (PPL) Antibody
20-abx005273
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Periplakin (PPL) Antibody
20-abx177959
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Periplakin (PPL) Antibody
20-abx100391
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Periplakin (PPL) Antibody
20-abx100392
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Periplakin (PPL) Antibody
abx038117-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Periplakin (PPL) Antibody
20-abx129708
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Recombinant Periplakin (PPL)
4-RPH334Hu01
  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60437
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Periplakin expressed in: E.coli
Recombinant Periplakin (PPL)
4-RPH334Hu02
  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60437
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 64.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Periplakin expressed in: E.coli
Recombinant Periplakin (PPL)
4-RPH334Mu01
  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9R269
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.1kDa
  • Isoelectric Point: 6
Description: Recombinant Mouse Periplakin expressed in: E.coli
Periplakin (PPL) Polyclonal Antibody (Mouse)
4-PAH334Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL)
ELISA kit for Human PPL (Periplakin)
ELK3840 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Periplakin (PPL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Periplakin (PPL).
  • Show more
Description: A sandwich ELISA kit for detection of Periplakin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Periplakin (PPL) CLIA Kit
20-abx495434
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Anti-Periplakin/PPL Antibody
A02098-1 100ug/vial
EUR 334
Human Periplakin (PPL) Protein
20-abx068469
  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Periplakin (PPL) Protein
20-abx068470
  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Periplakin (PPL) Polyclonal Antibody (Mouse), APC
4-PAH334Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with APC.
Periplakin (PPL) Polyclonal Antibody (Mouse), Biotinylated
4-PAH334Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with Biotin.
Periplakin (PPL) Polyclonal Antibody (Mouse), Cy3
4-PAH334Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with Cy3.
Periplakin (PPL) Polyclonal Antibody (Mouse), FITC
4-PAH334Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with FITC.
Periplakin (PPL) Polyclonal Antibody (Mouse), HRP
4-PAH334Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with HRP.
Periplakin (PPL) Polyclonal Antibody (Mouse), PE
4-PAH334Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with PE.
Periplakin (PPL) Polyclonal Antibody (Human)
4-PAH334Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL)
Periplakin (PPL) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH334Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with APC-Cy7.
Periplakin (PPL) Polyclonal Antibody (Human, Pig)
4-PAH334Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL)
Periplakin (PPL) Polyclonal Antibody (Human), APC
4-PAH334Hu02-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with APC.
Periplakin (PPL) Polyclonal Antibody (Human), Biotinylated
4-PAH334Hu02-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with Biotin.
Periplakin (PPL) Polyclonal Antibody (Human), Cy3
4-PAH334Hu02-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with Cy3.
Periplakin (PPL) Polyclonal Antibody (Human), FITC
4-PAH334Hu02-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with FITC.
Periplakin (PPL) Polyclonal Antibody (Human), HRP
4-PAH334Hu02-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with HRP.
Periplakin (PPL) Polyclonal Antibody (Human), PE
4-PAH334Hu02-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with PE.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), APC
4-PAH334Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with APC.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAH334Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with Biotin.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), Cy3
4-PAH334Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with Cy3.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), FITC
4-PAH334Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with FITC.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), HRP
4-PAH334Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with HRP.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), PE
4-PAH334Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with PE.
Periplakin (PPL) Polyclonal Antibody (Human), APC-Cy7
4-PAH334Hu02-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with APC-Cy7.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAH334Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with APC-Cy7.
Periplakin antibody
70R-2652 50 ug
EUR 467
Description: Rabbit polyclonal Periplakin antibody raised against the middle region of PPL
Periplakin Antibody
20-abx141927
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Periplakin antibody
PAab10072 100 ug
EUR 386
Mouse PPL shRNA Plasmid
20-abx972164
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
PPL antibody
20R-2607 100 uL
EUR 571
Description: Guinea Pig polyclonal Periplakin antibody
PPL Antibody
39987-100ul 100ul
EUR 390
PPL siRNA
20-abx929423
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PPL siRNA
20-abx929424
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Periplakin Blocking Peptide
33R-2523 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPL antibody, catalog no. 70R-2652
anti- Periplakin antibody
FNab10072 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:20-1:200
  • Immunogen: periplakin
  • Uniprot ID: O60437
  • Gene ID: 5493
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against Periplakin
Ppl ORF Vector (Mouse) (pORF)
ORF054595 1.0 ug DNA
EUR 1572
PPL Polyclonal Antibody
30769-100ul 100ul
EUR 252
PPL Polyclonal Antibody
30769-50ul 50ul
EUR 187
PPL Polyclonal Antibody
28423-100ul 100ul
EUR 252
PPL Polyclonal Antibody
28423-50ul 50ul
EUR 187
PPL Rabbit pAb
A14051-100ul 100 ul
EUR 308
PPL Rabbit pAb
A14051-200ul 200 ul
EUR 459
PPL Rabbit pAb
A14051-20ul 20 ul
EUR 183
PPL Rabbit pAb
A14051-50ul 50 ul
EUR 223
PPL cloning plasmid
CSB-CL018488HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5271
  • Sequence: ATGAACTCGCTCTTCAGGAAGAGAAACAAAGGCAAATACAGCCCCACTGTGCAGACCCGGAGCATCTCTAACAAGGAGCTCTCGGAGCTGATCGAGCAGCTGCAGAAGAATGCCGACCAGGTGGAGAAGAACATCGTGGACACAGAGGCCAAGATGCAGAGTGACCTGGCTCGGC
  • Show more
Description: A cloning plasmid for the PPL gene.
PPL Rabbit pAb
A6950-100ul 100 ul
EUR 308
PPL Rabbit pAb
A6950-200ul 200 ul
EUR 459
PPL Rabbit pAb
A6950-20ul 20 ul
EUR 183
PPL Rabbit pAb
A6950-50ul 50 ul
EUR 223
Anti-PPL antibody
STJ29030 100 µl
EUR 277
Description: The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling.
Anti-PPL antibody
STJ115986 100 µl
EUR 277
Description: The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling.
Ppl sgRNA CRISPR Lentivector set (Mouse)
K3406501 3 x 1.0 ug
EUR 339
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
PPL Polyclonal Conjugated Antibody
C28423 100ul
EUR 397
PPL Polyclonal Conjugated Antibody
C30769 100ul
EUR 397
Human PPL shRNA Plasmid
20-abx953679
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Ppl sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3406502 1.0 ug DNA
EUR 154
Ppl sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3406503 1.0 ug DNA
EUR 154
Ppl sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3406504 1.0 ug DNA
EUR 154
PPL Protein Vector (Mouse) (pPB-C-His)
PV218378 500 ng
EUR 2924
PPL Protein Vector (Mouse) (pPB-N-His)
PV218379 500 ng
EUR 2924
PPL Protein Vector (Mouse) (pPM-C-HA)
PV218380 500 ng
EUR 2924
PPL Protein Vector (Mouse) (pPM-C-His)
PV218381 500 ng
EUR 2924
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Ppl ORF Vector (Rat) (pORF)
ORF073882 1.0 ug DNA
EUR 2080
PPL ORF Vector (Human) (pORF)
ORF014135 1.0 ug DNA
EUR 354
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
Ppl sgRNA CRISPR Lentivector set (Rat)
K6091101 3 x 1.0 ug
EUR 339
PPL sgRNA CRISPR Lentivector set (Human)
K1700201 3 x 1.0 ug
EUR 339
vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428
vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9
Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3406505 3 x 1.0 ug
EUR 376
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
Ppl sgRNA CRISPR Lentivector (Rat) (Target 1)
K6091102 1.0 ug DNA
EUR 154
Ppl sgRNA CRISPR Lentivector (Rat) (Target 2)
K6091103 1.0 ug DNA
EUR 154
Ppl sgRNA CRISPR Lentivector (Rat) (Target 3)
K6091104 1.0 ug DNA
EUR 154
PPL sgRNA CRISPR Lentivector (Human) (Target 1)
K1700202 1.0 ug DNA
EUR 154
PPL sgRNA CRISPR Lentivector (Human) (Target 2)
K1700203 1.0 ug DNA
EUR 154
PPL sgRNA CRISPR Lentivector (Human) (Target 3)
K1700204 1.0 ug DNA
EUR 154
PPL Protein Vector (Rat) (pPB-C-His)
PV295526 500 ng
EUR 2924
PPL Protein Vector (Rat) (pPB-N-His)
PV295527 500 ng
EUR 2924
PPL Protein Vector (Rat) (pPM-C-HA)
PV295528 500 ng
EUR 2924
PPL Protein Vector (Rat) (pPM-C-His)
PV295529 500 ng
EUR 2924
PPL Protein Vector (Human) (pPB-C-His)
PV056537 500 ng
EUR 481
PPL Protein Vector (Human) (pPB-N-His)
PV056538 500 ng
EUR 481
PPL Protein Vector (Human) (pPM-C-HA)
PV056539 500 ng
EUR 481
PPL Protein Vector (Human) (pPM-C-His)
PV056540 500 ng
EUR 481
Ppl 3'UTR Luciferase Stable Cell Line
TU116785 1.0 ml Ask for price
Ppl 3'UTR GFP Stable Cell Line
TU166785 1.0 ml Ask for price
Ppl 3'UTR Luciferase Stable Cell Line
TU216631 1.0 ml Ask for price
Ppl 3'UTR GFP Stable Cell Line
TU266631 1.0 ml Ask for price
PPL 3'UTR GFP Stable Cell Line
TU068602 1.0 ml
EUR 1394
PPL 3'UTR Luciferase Stable Cell Line
TU018602 1.0 ml
EUR 1394
Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3406506 1.0 ug DNA
EUR 167
Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3406507 1.0 ug DNA
EUR 167
Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3406508 1.0 ug DNA
EUR 167
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9
Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6091105 3 x 1.0 ug
EUR 376
PPL sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1700205 3 x 1.0 ug
EUR 376
AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6091106 1.0 ug DNA
EUR 167
Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6091107 1.0 ug DNA
EUR 167
Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6091108 1.0 ug DNA
EUR 167
PPL sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1700206 1.0 ug DNA
EUR 167
PPL sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1700207 1.0 ug DNA
EUR 167
PPL sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1700208 1.0 ug DNA
EUR 167
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Mouse PPL(Periplakin) ELISA Kit

Scroll to Top