Human DSE(Dermatan Sulfate Epimerase) ELISA Kit

Human DSE(Dermatan Sulfate Epimerase) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

RD-DSE-Hu-48Tests 48 Tests
EUR 563

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

RD-DSE-Hu-96Tests 96 Tests
EUR 783

Dermatan Sulfate Epimerase (DSE) Antibody

abx122408-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dermatan Sulfate Epimerase (DSE) Antibody

20-abx172088
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermatan Sulfate Epimerase (DSE) Antibody

20-abx176146
  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermatan Sulfate Epimerase (DSE) Antibody

20-abx312163
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermatan Sulfate Epimerase (DSE) Antibody

abx232542-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Dermatan Sulfate Epimerase (DSE) Antibody

abx232543-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human DSE(Dermatan Sulfate Epimerase) ELISA Kit

EH2963 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9UL01
  • Alias: DSE/Dermatan Sulfate Epimerase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Dermatan- sulfate epimerase, DSE ELISA KIT

ELI-26126h 96 Tests
EUR 824

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

20-abx151350
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx252352-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

SEL449Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermatan Sulfate Epimerase (DSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermatan Sulfate Epimerase (DSE) in Tissue homogenates and other biological fluids.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

SEL449Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermatan Sulfate Epimerase (DSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermatan Sulfate Epimerase (DSE) in Tissue homogenates and other biological fluids.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

SEL449Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermatan Sulfate Epimerase (DSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermatan Sulfate Epimerase (DSE) in Tissue homogenates and other biological fluids.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

SEL449Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermatan Sulfate Epimerase (DSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermatan Sulfate Epimerase (DSE) in Tissue homogenates and other biological fluids.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

4-SEL449Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dermatan Sulfate Epimerase elisa. Alternative names of the recognized antigen: DSEPI
  • SART2
  • Squamous Cell Carcinoma Antigen Recognized By T Cells 2
  • Chondroitin-glucuronate 5-epimerase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dermatan Sulfate Epimerase (DSE) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Dermatan Sulfate Epimerase (DSE) Protein

20-abx653160
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Pig Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx361139-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx362852-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Bovine Dermatan- sulfate epimerase, DSE ELISA KIT

ELI-09256b 96 Tests
EUR 928

Mouse Dermatan- sulfate epimerase, Dse ELISA KIT

ELI-31600m 96 Tests
EUR 865

Chicken Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx355938-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx359377-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx389047-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Dermatan Sulfate Epimerase (DSE) CLIA Kit

20-abx495929
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Dermatan Sulfate Epimerase (DSE) CLIA Kit

abx195547-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Dermatan Sulfate Epimerase (DSE) Antibody (HRP)

20-abx312164
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermatan Sulfate Epimerase (DSE) Antibody (FITC)

20-abx312165
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermatan Sulfate Epimerase (DSE) Antibody (Biotin)

20-abx312166
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Human DSE (Dermatan Sulfate Epimerase)

ELK6520 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermatan Sulfate Epimerase (DSE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to D
  • Show more
Description: A sandwich ELISA kit for detection of Dermatan Sulfate Epimerase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human DSE (Dermatan Sulfate Epimerase)

E-EL-H0369 1 plate of 96 wells
EUR 534
  • Gentaur's DSE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DSE. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DSE (Dermatan Sulfate Epimerase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Dermatan-sulfate epimerase (DSE)

KTE61976-48T 48T
EUR 332
  • DSE is a tumor-rejection antigen.Two transcript variants encoding the same protein have been found for this gene.Sequence analysis predicted that the 958-amino acid SART2 protein contains a signal peptide, 5 potential N-glycosylation sites, and 2 C-t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dermatan-sulfate epimerase (DSE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dermatan-sulfate epimerase (DSE)

KTE61976-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DSE is a tumor-rejection antigen.Two transcript variants encoding the same protein have been found for this gene.Sequence analysis predicted that the 958-amino acid SART2 protein contains a signal peptide, 5 potential N-glycosylation sites, and 2 C-t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dermatan-sulfate epimerase (DSE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dermatan-sulfate epimerase (DSE)

KTE61976-96T 96T
EUR 539
  • DSE is a tumor-rejection antigen.Two transcript variants encoding the same protein have been found for this gene.Sequence analysis predicted that the 958-amino acid SART2 protein contains a signal peptide, 5 potential N-glycosylation sites, and 2 C-t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dermatan-sulfate epimerase (DSE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLIA kit for Human DSE (Dermatan Sulfate Epimerase)

E-CL-H0300 1 plate of 96 wells
EUR 584
  • Gentaur's DSE CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human DSE . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human DSE (Dermatan Sulfate Epimerase) in samples from Serum, Plasma, Cell supernatant

Dse ELISA Kit| Mouse Dermatan-sulfate epimerase ELISA Kit

EF014676 96 Tests
EUR 689

DSE ELISA Kit| Bovine Dermatan-sulfate epimerase ELISA Kit

EF011307 96 Tests
EUR 689

Human Dermatan- sulfate epimerase- like protein, DSEL ELISA KIT

ELI-08823h 96 Tests
EUR 824

Mouse Dermatan- sulfate epimerase- like protein, Dsel ELISA KIT

ELI-48164m 96 Tests
EUR 865

Human Dermatan sulfate ELISA kit

E01D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dermatan sulfate ELISA kit

E01D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dermatan sulfate ELISA kit

E01D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human dermatan sulfate ELISA Kit

ELA-E0649h 96 Tests
EUR 824

Goat Dermatan sulfate ELISA kit

E06D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dermatan sulfate ELISA kit

E06D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dermatan sulfate ELISA kit

E06D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dermatan sulfate ELISA kit

E02D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dermatan sulfate ELISA kit

E02D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dermatan sulfate ELISA kit

E02D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dermatan sulfate ELISA kit

E03D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dermatan sulfate ELISA kit

E03D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dermatan sulfate ELISA kit

E03D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dermatan sulfate ELISA kit

E04D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dermatan sulfate ELISA kit

E04D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dermatan sulfate ELISA kit

E04D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dermatan sulfate ELISA kit

E08D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dermatan sulfate ELISA kit

E08D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dermatan sulfate ELISA kit

E08D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dermatan sulfate ELISA kit

E09D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dermatan sulfate ELISA kit

E09D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dermatan sulfate ELISA kit

E09D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dermatan sulfate ELISA kit

E07D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dermatan sulfate ELISA kit

E07D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dermatan sulfate ELISA kit

E07D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human dermatan sulfate(DS)ELISA Kit

GA-E1896HM-48T 48T
EUR 289

Human dermatan sulfate(DS)ELISA Kit

GA-E1896HM-96T 96T
EUR 466

Human Dermatan Sulfate (DS) ELISA Kit

abx252351-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human dermatan sulfate,DS ELISA Kit

201-12-1880 96 tests
EUR 440
  • This dermatan sulfate ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human dermatan sulfate,DS ELISA Kit

CN-04521H1 96T
EUR 449

Human dermatan sulfate,DS ELISA Kit

CN-04521H2 48T
EUR 299

Human dermatan sulfate(DS)ELISA Kit

QY-E02241 96T
EUR 400

Pig Dermatan Sulfate (DS) ELISA Kit

abx360975-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Dermatan Sulfate (DS) ELISA Kit

abx363022-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Dermatan Sulfate (DS) ELISA Kit

abx364126-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Guinea pig Dermatan sulfate ELISA kit

E05D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dermatan sulfate ELISA kit

E05D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dermatan sulfate ELISA kit

E05D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse dermatan sulfate(DS)ELISA Kit

GA-E0970MS-48T 48T
EUR 336

Mouse dermatan sulfate(DS)ELISA Kit

GA-E0970MS-96T 96T
EUR 534

Chicken Dermatan Sulfate (DS) ELISA Kit

abx356060-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Dermatan Sulfate (DS) ELISA Kit

abx359190-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Human DS (Dermatan Sulfate)

E-EL-H1725 1 plate of 96 wells
EUR 534
  • Gentaur's DS ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DS. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DS (Dermatan Sulfate) in samples from Serum, Plasma, Cell supernatant

Human Dermatan Sulfate (DS) CLIA Kit

abx196603-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CLIA kit for Human DS (Dermatan Sulfate)

E-CL-H1083 1 plate of 96 wells
EUR 584
  • Gentaur's DS CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human DS . Standards or samples are added to the micro CLIA plate wells and combined with the spec
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human DS (Dermatan Sulfate) in samples from Serum, Plasma, Cell supernatant

DSE ELISA KIT|Human

EF006766 96 Tests
EUR 689

DSE siRNA

20-abx914656
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DSE siRNA

20-abx914657
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DSE Antibody

1-CSB-PA890925LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSE. Recognizes DSE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DSE Antibody

DF12961 200ul
EUR 304
Description: DSE Antibody detects endogenous levels of DSE.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human DSE shRNA Plasmid

20-abx959282
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Aldose 1 epimerase(GALM) ELISA kit

E01A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose 1 epimerase(GALM) ELISA kit

E01A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose 1 epimerase(GALM) ELISA kit

E01A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose 1- epimerase, GALM ELISA KIT

ELI-26610h 96 Tests
EUR 824

Human Methylmalonyl-CoA Epimerase (MCEE) ELISA Kit

abx381372-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Glucuronic Acid Epimerase (GLCE) ELISA Kit

abx384960-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Aldose 1-Epimerase (GALM) ELISA Kit

abx387482-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Dehydroepiandrosterone sulfate ELISA kit

E01D0233-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dehydroepiandrosterone sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dehydroepiandrosterone sulfate ELISA kit

E01D0233-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dehydroepiandrosterone sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dehydroepiandrosterone sulfate ELISA kit

E01D0233-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dehydroepiandrosterone sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Indoxyl Sulfate ELISA kit

E01I0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Indoxyl Sulfate ELISA kit

E01I0039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Indoxyl Sulfate ELISA kit

E01I0039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human keratan sulfate ELISA kit

E01K0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human keratan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human keratan sulfate ELISA kit

E01K0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human keratan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human keratan sulfate ELISA kit

E01K0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human keratan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chondroitin sulfate ELISA kit

E01C0829-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chondroitin sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chondroitin sulfate ELISA kit

E01C0829-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chondroitin sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chondroitin sulfate ELISA kit

E01C0829-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chondroitin sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dehydroepiandrosterone sulfate ELISA Kit

ELA-E0460h 96 Tests
EUR 824

Human keratan sulfate ELISA Kit

ELA-E0590h 96 Tests
EUR 824

Human melatonin sulfate ELISA Kit

ELA-E1169h 96 Tests
EUR 824

anti- DSE antibody

FNab02542 100µg
EUR 585
  • Immunogen: dermatan sulfate epimerase
  • Uniprot ID: Q9UL01
  • Gene ID: 29940
  • Research Area: Metabolism
Description: Antibody raised against DSE

anti- DSE antibody

FNab02543 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: dermatan sulfate epimerase
  • Uniprot ID: Q9UL01
  • Gene ID: 29940
  • Research Area: Metabolism
Description: Antibody raised against DSE

DSE Polyclonal Antibody

A58858 100 µg
EUR 570.55
Description: The best epigenetics products

DSE Blocking Peptide

DF12961-BP 1mg
EUR 195

DSE cloning plasmid

CSB-CL890925HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2877
  • Sequence: atgaggactcacacacggggggctcccagtgtgtttttcatatatttgctttgctttgtgtcagcctacatcaccgacgagaacccagaagttatgattcccttcaccaatgccaactacgacagccatcccatgctgtacttctccagggcagaagtggcggagctgcagctca
  • Show more
Description: A cloning plasmid for the DSE gene.

Anti-DSE antibody

PAab02542 100 ug
EUR 412

Human UDP-glucose 4-epimerase(GALE) ELISA kit

E01U0079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP-glucose 4-epimerase(GALE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UDP-glucose 4-epimerase(GALE) ELISA kit

E01U0079-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP-glucose 4-epimerase(GALE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UDP-glucose 4-epimerase(GALE) ELISA kit

E01U0079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP-glucose 4-epimerase(GALE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit

E01N0571-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit

E01N0571-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit

E01N0571-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epimerase family protein SDR39U1, SDR39U1 ELISA KIT

ELI-10316h 96 Tests
EUR 824

Human UDP- glucose 4- epimerase, GALE ELISA KIT

ELI-26608h 96 Tests
EUR 824

Human Ribulose- phosphate 3- epimerase, RPE ELISA KIT

ELI-53196h 96 Tests
EUR 824

Human N- acylglucosamine 2- epimerase, RENBP ELISA KIT

ELI-42843h 96 Tests
EUR 824

Human D- glucuronyl C5- epimerase, GLCE ELISA KIT

ELI-47228h 96 Tests
EUR 824

Human Ribulose-phosphate 3-epimerase (RPE) ELISA Kit

abx382889-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human UDP-Glucose 4-Epimerase (GALE) ELISA Kit

20-abx387479
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human UDP Galactose-4-Epimerase(GALE)ELISA Kit

QY-E04503 96T
EUR 361

DSE ORF Vector (Human) (pORF)

ORF003285 1.0 ug DNA
EUR 95

Human Melatonin Sulfate (6-Hydroxymelatonin Sulfate) (6-SM) ELISA Kit

abx252777-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Heparan sulfate, HS ELISA Kit

CELI-66081h 96 Tests
EUR 824

Human heparan sulfate,HS ELISA kit

E01H1352-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human heparan sulfate,HS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human heparan sulfate,HS ELISA kit

E01H1352-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human heparan sulfate,HS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human heparan sulfate,HS ELISA kit

E01H1352-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human heparan sulfate,HS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human HS(Heparan Sulfate) ELISA Kit

EH4010 96T
EUR 524.1
  • Detection range: 78-5000 ng/ml
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9 ng/ml

Human Heparan sulfate, HS ELISA Kit

ELA-E0623h 96 Tests
EUR 824

Human chondroitin sulfate, CS ELISA Kit

ELA-E0723h 96 Tests
EUR 824

Human Sulfate transporter, SLC26A2 ELISA KIT

ELI-18370h 96 Tests
EUR 824

Human melatonin sulfate(MS)ELISA Kit

GA-E1062HM-48T 48T
EUR 289

Human melatonin sulfate(MS)ELISA Kit

GA-E1062HM-96T 96T
EUR 466

Human keratan sulfate(KS)ELISA Kit

GA-E1476HM-48T 48T
EUR 289

Human keratan sulfate(KS)ELISA Kit

GA-E1476HM-96T 96T
EUR 466

Human chondroitin sulfate(CS)ELISA Kit

GA-E1912HM-48T 48T
EUR 289

Human chondroitin sulfate(CS)ELISA Kit

GA-E1912HM-96T 96T
EUR 466

Human Heparan Sulfate (HS) ELISA Kit

abx257490-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human melatonin sulfate,MS ELISA Kit

201-12-1046 96 tests
EUR 440
  • This melatonin sulfate ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human keratan sulfate,KS ELISA Kit

201-12-1460 96 tests
EUR 440
  • This keratan sulfate ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human chondroitin sulfate,CS ELISA Kit

201-12-1896 96 tests
EUR 440
  • This chondroitin sulfate ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Keratan sulfate, KS ELISA Kit

CELI-66087h 96 Tests
EUR 824

Human melatonin sulfate,MS ELISA Kit

CN-04616H1 96T
EUR 455

Human melatonin sulfate,MS ELISA Kit

CN-04616H2 48T
EUR 304

Human heparan sulfate, HS ELISA Kit

CSB-E09585h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human heparan sulfate, HS in samples from serum, plasma, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human heparan sulfate, HS ELISA Kit

1-CSB-E09585h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human heparan sulfate, HS in samples from serum, plasma, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human chondroitin sulfate,CS ELISA Kit

CN-04520H1 96T
EUR 449

Human chondroitin sulfate,CS ELISA Kit

CN-04520H2 48T
EUR 299

Human heparan sulfate,HS ELISA Kit

CN-04522H1 96T
EUR 471

Human heparan sulfate,HS ELISA Kit

CN-04522H2 48T
EUR 322

Human keratan sulfate,KS ELISA Kit

CN-04523H1 96T
EUR 449

Human keratan sulfate,KS ELISA Kit

CN-04523H2 48T
EUR 299

Human melatonin sulfate(MS)ELISA Kit

QY-E02239 96T
EUR 400

Human chondroitin sulfate(CS)ELISA Kit

QY-E02240 96T
EUR 400

Human keratan sulfate(KS)ELISA Kit

QY-E02244 96T
EUR 361

Human MS(Melatonin Sulfate)ELISA Kit

STJ150457 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of MS in human serum, plasma and other biological fluids

Goat Aldose 1 epimerase(GALM) ELISA kit

E06A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aldose 1 epimerase(GALM) ELISA kit

E06A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aldose 1 epimerase(GALM) ELISA kit

E06A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldose 1 epimerase(GALM) ELISA kit

E03A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldose 1 epimerase(GALM) ELISA kit

E03A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldose 1 epimerase(GALM) ELISA kit

E03A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aldose 1 epimerase(GALM) ELISA kit

E04A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aldose 1 epimerase(GALM) ELISA kit

E04A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aldose 1 epimerase(GALM) ELISA kit

E04A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aldose 1 epimerase(GALM) ELISA kit

E02A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aldose 1 epimerase(GALM) ELISA kit

E02A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aldose 1 epimerase(GALM) ELISA kit

E02A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aldose 1 epimerase(GALM) ELISA kit

E07A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aldose 1 epimerase(GALM) ELISA kit

E07A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aldose 1 epimerase(GALM) ELISA kit

E07A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aldose 1 epimerase(GALM) ELISA kit

E09A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aldose 1 epimerase(GALM) ELISA kit

E09A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aldose 1 epimerase(GALM) ELISA kit

E09A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aldose 1 epimerase(GALM) ELISA kit

E08A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aldose 1 epimerase(GALM) ELISA kit

E08A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aldose 1 epimerase(GALM) ELISA kit

E08A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine Aldose 1- epimerase, GALM ELISA KIT

ELI-13171p 96 Tests
EUR 928

Mouse Aldose 1- epimerase, Galm ELISA KIT

ELI-27154m 96 Tests
EUR 865

Bovine Aldose 1- epimerase, GALM ELISA KIT

ELI-32456b 96 Tests
EUR 928

Rat Glucuronic Acid Epimerase (GLCE) ELISA Kit

20-abx155579
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Aldose 1-Epimerase (GALM) ELISA Kit

abx389377-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Glucuronic Acid Epimerase (GLCE) ELISA Kit

abx389415-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Aldose 1-Epimerase (GALM) ELISA Kit

abx391371-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Glucuronic Acid Epimerase (GLCE) ELISA Kit

SEJ028Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Glucuronic Acid Epimerase (GLCE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Glucuronic Acid Epimerase (GLCE) in Tissue homogenates, cell lysates and other biological fluids.

Rat Glucuronic Acid Epimerase (GLCE) ELISA Kit

SEJ028Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Glucuronic Acid Epimerase (GLCE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Glucuronic Acid Epimerase (GLCE) in Tissue homogenates, cell lysates and other biological fluids.

Rat Glucuronic Acid Epimerase (GLCE) ELISA Kit

SEJ028Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Glucuronic Acid Epimerase (GLCE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Glucuronic Acid Epimerase (GLCE) in Tissue homogenates, cell lysates and other biological fluids.

Rat Glucuronic Acid Epimerase (GLCE) ELISA Kit

SEJ028Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Glucuronic Acid Epimerase (GLCE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Glucuronic Acid Epimerase (GLCE) in Tissue homogenates, cell lysates and other biological fluids.

Rat Glucuronic Acid Epimerase (GLCE) ELISA Kit

4-SEJ028Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glucuronic Acid Epimerase elisa. Alternative names of the recognized antigen: HSEPI
  • D-Glucuronyl C5-Epimerase
  • UDP-Glucuronic Acid Epimerase
  • Heparan Sulfate Epimerase
  • Heparin/heparan sulfate:glucuronic acid C5-epimerase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Glucuronic Acid Epimerase (GLCE) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Galm ELISA Kit| Rat Aldose 1-epimerase ELISA Kit

EF018727 96 Tests
EUR 689

Galm ELISA Kit| Mouse Aldose 1-epimerase ELISA Kit

EF015010 96 Tests
EUR 689

GALM ELISA Kit| Bovine Aldose 1-epimerase ELISA Kit

EF011416 96 Tests
EUR 689

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse DSE shRNA Plasmid

20-abx980772
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DSE Antibody, HRP conjugated

1-CSB-PA890925LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSE. Recognizes DSE from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DSE Antibody, FITC conjugated

1-CSB-PA890925LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSE. Recognizes DSE from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DSE Antibody, Biotin conjugated

1-CSB-PA890925LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSE. Recognizes DSE from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ELISA kit for Human NAD (P)H-hydrate epimerase

EK2637 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NAD (P)H-hydrate epimerase in samples from serum, plasma, tissue homogenates and other biological fluids.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

DSE sgRNA CRISPR Lentivector set (Human)

K0634101 3 x 1.0 ug
EUR 339

Melatonin Sulfate (6-Hydroxymelatonin Sulfate) (6-SM) ELISA Kit

abx259368-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Keratan Sulfate (KS) ELISA Kit

abx513444-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Heparan Sulfate (HS) ELISA Kit

abx513537-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Heparan Sulfate (HS) ELISA Kit

20-abx585370
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Chondroitin Sulfate (CS) ELISA Kit

abx572082-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Goat Dehydroepiandrosterone sulfate ELISA kit

E06D0233-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dehydroepiandrosterone sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dehydroepiandrosterone sulfate ELISA kit

E06D0233-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dehydroepiandrosterone sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dehydroepiandrosterone sulfate ELISA kit

E06D0233-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dehydroepiandrosterone sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chondroitin sulfate ELISA kit

E06C0829-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Chondroitin sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chondroitin sulfate ELISA kit

E06C0829-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Chondroitin sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chondroitin sulfate ELISA kit

E06C0829-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Chondroitin sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Indoxyl Sulfate ELISA kit

E06I0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Indoxyl Sulfate ELISA kit

E06I0039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Indoxyl Sulfate ELISA kit

E06I0039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DSE(Dermatan Sulfate Epimerase) ELISA Kit

Scroll to Top