Human DSE(Dermatan Sulfate Epimerase) ELISA Kit

Human DSE(Dermatan Sulfate Epimerase) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

RD-DSE-Hu-48Tests 48 Tests
EUR 563

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

RD-DSE-Hu-96Tests 96 Tests
EUR 783

Dermatan Sulfate Epimerase (DSE) Antibody

20-abx176146
  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermatan Sulfate Epimerase (DSE) Antibody

abx122408-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dermatan Sulfate Epimerase (DSE) Antibody

20-abx172088
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermatan Sulfate Epimerase (DSE) Antibody

20-abx312163
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermatan Sulfate Epimerase (DSE) Antibody

abx232542-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Dermatan Sulfate Epimerase (DSE) Antibody

abx232543-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

20-abx151350
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx252352-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human DSE(Dermatan Sulfate Epimerase) ELISA Kit

EH2963 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9UL01
  • Alias: DSE/Dermatan Sulfate Epimerase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Dermatan- sulfate epimerase, DSE ELISA KIT

ELI-26126h 96 Tests
EUR 824

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

SEL449Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermatan Sulfate Epimerase (DSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermatan Sulfate Epimerase (DSE) in Tissue homogenates and other biological fluids.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

SEL449Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermatan Sulfate Epimerase (DSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermatan Sulfate Epimerase (DSE) in Tissue homogenates and other biological fluids.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

SEL449Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermatan Sulfate Epimerase (DSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermatan Sulfate Epimerase (DSE) in Tissue homogenates and other biological fluids.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

SEL449Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermatan Sulfate Epimerase (DSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermatan Sulfate Epimerase (DSE) in Tissue homogenates and other biological fluids.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

4-SEL449Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dermatan Sulfate Epimerase elisa. Alternative names of the recognized antigen: DSEPI
  • SART2
  • Squamous Cell Carcinoma Antigen Recognized By T Cells 2
  • Chondroitin-glucuronate 5-epimerase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dermatan Sulfate Epimerase (DSE) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Dermatan Sulfate Epimerase (DSE) Protein

20-abx653160
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Bovine Dermatan- sulfate epimerase, DSE ELISA KIT

ELI-09256b 96 Tests
EUR 928

Mouse Dermatan- sulfate epimerase, Dse ELISA KIT

ELI-31600m 96 Tests
EUR 865

Monkey Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx359377-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx361139-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx362852-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx355938-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx389047-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Dermatan Sulfate Epimerase (DSE) CLIA Kit

abx195547-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Dermatan Sulfate Epimerase (DSE) CLIA Kit

20-abx495929
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Dermatan Sulfate Epimerase (DSE) Antibody (HRP)

20-abx312164
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermatan Sulfate Epimerase (DSE) Antibody (FITC)

20-abx312165
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermatan Sulfate Epimerase (DSE) Antibody (Biotin)

20-abx312166
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Human DSE (Dermatan Sulfate Epimerase)

E-EL-H0369 1 plate of 96 wells
EUR 534
  • Gentaur's DSE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DSE. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DSE (Dermatan Sulfate Epimerase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human DSE (Dermatan Sulfate Epimerase)

ELK6520 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermatan Sulfate Epimerase (DSE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to D
  • Show more
Description: A sandwich ELISA kit for detection of Dermatan Sulfate Epimerase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Dermatan-sulfate epimerase (DSE)

KTE61976-48T 48T
EUR 332
  • DSE is a tumor-rejection antigen.Two transcript variants encoding the same protein have been found for this gene.Sequence analysis predicted that the 958-amino acid SART2 protein contains a signal peptide, 5 potential N-glycosylation sites, and 2 C-t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dermatan-sulfate epimerase (DSE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dermatan-sulfate epimerase (DSE)

KTE61976-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DSE is a tumor-rejection antigen.Two transcript variants encoding the same protein have been found for this gene.Sequence analysis predicted that the 958-amino acid SART2 protein contains a signal peptide, 5 potential N-glycosylation sites, and 2 C-t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dermatan-sulfate epimerase (DSE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dermatan-sulfate epimerase (DSE)

KTE61976-96T 96T
EUR 539
  • DSE is a tumor-rejection antigen.Two transcript variants encoding the same protein have been found for this gene.Sequence analysis predicted that the 958-amino acid SART2 protein contains a signal peptide, 5 potential N-glycosylation sites, and 2 C-t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dermatan-sulfate epimerase (DSE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLIA kit for Human DSE (Dermatan Sulfate Epimerase)

E-CL-H0300 1 plate of 96 wells
EUR 584
  • Gentaur's DSE CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human DSE . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human DSE (Dermatan Sulfate Epimerase) in samples from Serum, Plasma, Cell supernatant

Dse ELISA Kit| Mouse Dermatan-sulfate epimerase ELISA Kit

EF014676 96 Tests
EUR 689

DSE ELISA Kit| Bovine Dermatan-sulfate epimerase ELISA Kit

EF011307 96 Tests
EUR 689

Human Dermatan- sulfate epimerase- like protein, DSEL ELISA KIT

ELI-08823h 96 Tests
EUR 824

Mouse Dermatan- sulfate epimerase- like protein, Dsel ELISA KIT

ELI-48164m 96 Tests
EUR 865

Human Dermatan sulfate ELISA kit

E01D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dermatan sulfate ELISA kit

E01D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dermatan sulfate ELISA kit

E01D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human dermatan sulfate ELISA Kit

ELA-E0649h 96 Tests
EUR 824

Rat Dermatan sulfate ELISA kit

E02D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dermatan sulfate ELISA kit

E02D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dermatan sulfate ELISA kit

E02D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dermatan sulfate ELISA kit

E03D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dermatan sulfate ELISA kit

E03D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dermatan sulfate ELISA kit

E03D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dermatan sulfate ELISA kit

E06D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dermatan sulfate ELISA kit

E06D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dermatan sulfate ELISA kit

E06D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dermatan sulfate ELISA kit

E04D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dermatan sulfate ELISA kit

E04D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dermatan sulfate ELISA kit

E04D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dermatan sulfate ELISA kit

E09D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dermatan sulfate ELISA kit

E09D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dermatan sulfate ELISA kit

E09D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dermatan sulfate ELISA kit

E08D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dermatan sulfate ELISA kit

E08D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dermatan sulfate ELISA kit

E08D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dermatan sulfate ELISA kit

E07D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dermatan sulfate ELISA kit

E07D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dermatan sulfate ELISA kit

E07D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human dermatan sulfate,DS ELISA Kit

201-12-1880 96 tests
EUR 440
  • This dermatan sulfate ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Dermatan Sulfate (DS) ELISA Kit

abx252351-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human dermatan sulfate,DS ELISA Kit

CN-04521H1 96T
EUR 449

Human dermatan sulfate,DS ELISA Kit

CN-04521H2 48T
EUR 299

Human dermatan sulfate(DS)ELISA Kit

GA-E1896HM-48T 48T
EUR 289

Human dermatan sulfate(DS)ELISA Kit

GA-E1896HM-96T 96T
EUR 466

Human dermatan sulfate(DS)ELISA Kit

QY-E02241 96T
EUR 400

Guinea pig Dermatan sulfate ELISA kit

E05D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dermatan sulfate ELISA kit

E05D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dermatan sulfate ELISA kit

E05D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dermatan Sulfate (DS) ELISA Kit

abx360975-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Dermatan Sulfate (DS) ELISA Kit

abx363022-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Dermatan Sulfate (DS) ELISA Kit

abx356060-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Dermatan Sulfate (DS) ELISA Kit

abx359190-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Dermatan Sulfate (DS) ELISA Kit

abx364126-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Mouse dermatan sulfate(DS)ELISA Kit

GA-E0970MS-48T 48T
EUR 336

Mouse dermatan sulfate(DS)ELISA Kit

GA-E0970MS-96T 96T
EUR 534

ELISA kit for Human DS (Dermatan Sulfate)

E-EL-H1725 1 plate of 96 wells
EUR 534
  • Gentaur's DS ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DS. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DS (Dermatan Sulfate) in samples from Serum, Plasma, Cell supernatant

Human Dermatan Sulfate (DS) CLIA Kit

abx196603-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CLIA kit for Human DS (Dermatan Sulfate)

E-CL-H1083 1 plate of 96 wells
EUR 584
  • Gentaur's DS CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human DS . Standards or samples are added to the micro CLIA plate wells and combined with the spec
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human DS (Dermatan Sulfate) in samples from Serum, Plasma, Cell supernatant

DSE ELISA KIT|Human

EF006766 96 Tests
EUR 689

DSE ELISA Kit (Human) (OKCD02047)

OKCD02047 96 Wells
EUR 909
Description: Description of target: Converts D-glucuronic acid to L-iduronic acid (IdoUA) residues.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.114 ng/mL

DSE Antibody

1-CSB-PA890925LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSE. Recognizes DSE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DSE Antibody

DF12961 200ul
EUR 304
Description: DSE Antibody detects endogenous levels of DSE.

DSE siRNA

20-abx914656
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DSE siRNA

20-abx914657
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human DSE shRNA Plasmid

20-abx959282
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Aldose 1 epimerase(GALM) ELISA kit

E01A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose 1 epimerase(GALM) ELISA kit

E01A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose 1 epimerase(GALM) ELISA kit

E01A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose 1- epimerase, GALM ELISA KIT

ELI-26610h 96 Tests
EUR 824

Human Glucuronic Acid Epimerase (GLCE) ELISA Kit

abx384960-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Methylmalonyl-CoA Epimerase (MCEE) ELISA Kit

abx381372-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Aldose 1-Epimerase (GALM) ELISA Kit

abx387482-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Chondroitin sulfate ELISA kit

E01C0829-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chondroitin sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chondroitin sulfate ELISA kit

E01C0829-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chondroitin sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chondroitin sulfate ELISA kit

E01C0829-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chondroitin sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dehydroepiandrosterone sulfate ELISA kit

E01D0233-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dehydroepiandrosterone sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dehydroepiandrosterone sulfate ELISA kit

E01D0233-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dehydroepiandrosterone sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dehydroepiandrosterone sulfate ELISA kit

E01D0233-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dehydroepiandrosterone sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Indoxyl Sulfate ELISA kit

E01I0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Indoxyl Sulfate ELISA kit

E01I0039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Indoxyl Sulfate ELISA kit

E01I0039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human keratan sulfate ELISA kit

E01K0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human keratan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human keratan sulfate ELISA kit

E01K0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human keratan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human keratan sulfate ELISA kit

E01K0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human keratan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dehydroepiandrosterone sulfate ELISA Kit

ELA-E0460h 96 Tests
EUR 824

Human keratan sulfate ELISA Kit

ELA-E0590h 96 Tests
EUR 824

Human melatonin sulfate ELISA Kit

ELA-E1169h 96 Tests
EUR 824

DSE cloning plasmid

CSB-CL890925HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2877
  • Sequence: atgaggactcacacacggggggctcccagtgtgtttttcatatatttgctttgctttgtgtcagcctacatcaccgacgagaacccagaagttatgattcccttcaccaatgccaactacgacagccatcccatgctgtacttctccagggcagaagtggcggagctgcagctca
  • Show more
Description: A cloning plasmid for the DSE gene.

DSE Blocking Peptide

DF12961-BP 1mg
EUR 195

DSE Polyclonal Antibody

A58858 100 µg
EUR 570.55
Description: The best epigenetics products

anti- DSE antibody

FNab02542 100µg
EUR 585
  • Immunogen: dermatan sulfate epimerase
  • Uniprot ID: Q9UL01
  • Gene ID: 29940
  • Research Area: Metabolism
Description: Antibody raised against DSE

anti- DSE antibody

FNab02543 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: dermatan sulfate epimerase
  • Uniprot ID: Q9UL01
  • Gene ID: 29940
  • Research Area: Metabolism
Description: Antibody raised against DSE

Anti-DSE antibody

PAab02542 100 ug
EUR 412

DSE ORF Vector (Human) (pORF)

ORF003285 1.0 ug DNA
EUR 95

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit

E01N0571-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit

E01N0571-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit

E01N0571-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UDP-glucose 4-epimerase(GALE) ELISA kit

E01U0079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP-glucose 4-epimerase(GALE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UDP-glucose 4-epimerase(GALE) ELISA kit

E01U0079-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP-glucose 4-epimerase(GALE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UDP-glucose 4-epimerase(GALE) ELISA kit

E01U0079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP-glucose 4-epimerase(GALE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epimerase family protein SDR39U1, SDR39U1 ELISA KIT

ELI-10316h 96 Tests
EUR 824

Human UDP- glucose 4- epimerase, GALE ELISA KIT

ELI-26608h 96 Tests
EUR 824

Human Ribulose- phosphate 3- epimerase, RPE ELISA KIT

ELI-53196h 96 Tests
EUR 824

Human N- acylglucosamine 2- epimerase, RENBP ELISA KIT

ELI-42843h 96 Tests
EUR 824

Human Ribulose-phosphate 3-epimerase (RPE) ELISA Kit

abx382889-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human UDP-Glucose 4-Epimerase (GALE) ELISA Kit

20-abx387479
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human D- glucuronyl C5- epimerase, GLCE ELISA KIT

ELI-47228h 96 Tests
EUR 824

Human UDP Galactose-4-Epimerase(GALE)ELISA Kit

QY-E04503 96T
EUR 361

Human Melatonin Sulfate (6-Hydroxymelatonin Sulfate) (6-SM) ELISA Kit

abx252777-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human melatonin sulfate,MS ELISA Kit

201-12-1046 96 tests
EUR 440
  • This melatonin sulfate ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human keratan sulfate,KS ELISA Kit

201-12-1460 96 tests
EUR 440
  • This keratan sulfate ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human chondroitin sulfate,CS ELISA Kit

201-12-1896 96 tests
EUR 440
  • This chondroitin sulfate ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human heparan sulfate,HS ELISA kit

E01H1352-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human heparan sulfate,HS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human heparan sulfate,HS ELISA kit

E01H1352-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human heparan sulfate,HS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human heparan sulfate,HS ELISA kit

E01H1352-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human heparan sulfate,HS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heparan Sulfate (HS) ELISA Kit

abx257490-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human HS(Heparan Sulfate) ELISA Kit

EH4010 96T
EUR 524.1
  • Detection range: 78-5000 ng/ml
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9 ng/ml

Human Heparan sulfate, HS ELISA Kit

ELA-E0623h 96 Tests
EUR 824

Human chondroitin sulfate, CS ELISA Kit

ELA-E0723h 96 Tests
EUR 824

Human Sulfate transporter, SLC26A2 ELISA KIT

ELI-18370h 96 Tests
EUR 824

Human Heparan sulfate, HS ELISA Kit

CELI-66081h 96 Tests
EUR 824

Human Keratan sulfate, KS ELISA Kit

CELI-66087h 96 Tests
EUR 824

Human chondroitin sulfate,CS ELISA Kit

CN-04520H1 96T
EUR 449

Human chondroitin sulfate,CS ELISA Kit

CN-04520H2 48T
EUR 299

Human heparan sulfate,HS ELISA Kit

CN-04522H1 96T
EUR 471

Human heparan sulfate,HS ELISA Kit

CN-04522H2 48T
EUR 322

Human keratan sulfate,KS ELISA Kit

CN-04523H1 96T
EUR 449

Human keratan sulfate,KS ELISA Kit

CN-04523H2 48T
EUR 299

Human heparan sulfate, HS ELISA Kit

CSB-E09585h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human heparan sulfate, HS in samples from serum, plasma, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human heparan sulfate, HS ELISA Kit

1-CSB-E09585h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human heparan sulfate, HS in samples from serum, plasma, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human melatonin sulfate,MS ELISA Kit

CN-04616H1 96T
EUR 455

Human melatonin sulfate,MS ELISA Kit

CN-04616H2 48T
EUR 304

Human keratan sulfate(KS)ELISA Kit

GA-E1476HM-48T 48T
EUR 289

Human keratan sulfate(KS)ELISA Kit

GA-E1476HM-96T 96T
EUR 466

Human chondroitin sulfate(CS)ELISA Kit

GA-E1912HM-48T 48T
EUR 289

Human chondroitin sulfate(CS)ELISA Kit

GA-E1912HM-96T 96T
EUR 466

Human melatonin sulfate(MS)ELISA Kit

GA-E1062HM-48T 48T
EUR 289

Human melatonin sulfate(MS)ELISA Kit

GA-E1062HM-96T 96T
EUR 466

Human melatonin sulfate(MS)ELISA Kit

QY-E02239 96T
EUR 400

Human chondroitin sulfate(CS)ELISA Kit

QY-E02240 96T
EUR 400

Human keratan sulfate(KS)ELISA Kit

QY-E02244 96T
EUR 361

Human MS(Melatonin Sulfate)ELISA Kit

STJ150457 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of MS in human serum, plasma and other biological fluids

Rat Aldose 1 epimerase(GALM) ELISA kit

E02A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aldose 1 epimerase(GALM) ELISA kit

E02A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aldose 1 epimerase(GALM) ELISA kit

E02A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aldose 1 epimerase(GALM) ELISA kit

E06A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aldose 1 epimerase(GALM) ELISA kit

E06A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aldose 1 epimerase(GALM) ELISA kit

E06A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldose 1 epimerase(GALM) ELISA kit

E03A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldose 1 epimerase(GALM) ELISA kit

E03A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldose 1 epimerase(GALM) ELISA kit

E03A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aldose 1 epimerase(GALM) ELISA kit

E04A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aldose 1 epimerase(GALM) ELISA kit

E04A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aldose 1 epimerase(GALM) ELISA kit

E04A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aldose 1 epimerase(GALM) ELISA kit

E07A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aldose 1 epimerase(GALM) ELISA kit

E07A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aldose 1 epimerase(GALM) ELISA kit

E07A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glucuronic Acid Epimerase (GLCE) ELISA Kit

20-abx155579
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Dog Aldose 1 epimerase(GALM) ELISA kit

E08A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aldose 1 epimerase(GALM) ELISA kit

E08A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aldose 1 epimerase(GALM) ELISA kit

E08A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aldose 1 epimerase(GALM) ELISA kit

E09A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aldose 1 epimerase(GALM) ELISA kit

E09A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aldose 1 epimerase(GALM) ELISA kit

E09A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine Aldose 1- epimerase, GALM ELISA KIT

ELI-13171p 96 Tests
EUR 928

Mouse Aldose 1- epimerase, Galm ELISA KIT

ELI-27154m 96 Tests
EUR 865

Rat Aldose 1-Epimerase (GALM) ELISA Kit

abx391371-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Aldose 1-Epimerase (GALM) ELISA Kit

abx389377-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Glucuronic Acid Epimerase (GLCE) ELISA Kit

abx389415-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Bovine Aldose 1- epimerase, GALM ELISA KIT

ELI-32456b 96 Tests
EUR 928

Rat Glucuronic Acid Epimerase (GLCE) ELISA Kit

SEJ028Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Glucuronic Acid Epimerase (GLCE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Glucuronic Acid Epimerase (GLCE) in Tissue homogenates, cell lysates and other biological fluids.

Rat Glucuronic Acid Epimerase (GLCE) ELISA Kit

SEJ028Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Glucuronic Acid Epimerase (GLCE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Glucuronic Acid Epimerase (GLCE) in Tissue homogenates, cell lysates and other biological fluids.

Rat Glucuronic Acid Epimerase (GLCE) ELISA Kit

SEJ028Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Glucuronic Acid Epimerase (GLCE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Glucuronic Acid Epimerase (GLCE) in Tissue homogenates, cell lysates and other biological fluids.

Rat Glucuronic Acid Epimerase (GLCE) ELISA Kit

SEJ028Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Glucuronic Acid Epimerase (GLCE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Glucuronic Acid Epimerase (GLCE) in Tissue homogenates, cell lysates and other biological fluids.

Rat Glucuronic Acid Epimerase (GLCE) ELISA Kit

4-SEJ028Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glucuronic Acid Epimerase elisa. Alternative names of the recognized antigen: HSEPI
  • D-Glucuronyl C5-Epimerase
  • UDP-Glucuronic Acid Epimerase
  • Heparan Sulfate Epimerase
  • Heparin/heparan sulfate:glucuronic acid C5-epimerase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Glucuronic Acid Epimerase (GLCE) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Galm ELISA Kit| Rat Aldose 1-epimerase ELISA Kit

EF018727 96 Tests
EUR 689

Galm ELISA Kit| Mouse Aldose 1-epimerase ELISA Kit

EF015010 96 Tests
EUR 689

GALM ELISA Kit| Bovine Aldose 1-epimerase ELISA Kit

EF011416 96 Tests
EUR 689

DSE Antibody, HRP conjugated

1-CSB-PA890925LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSE. Recognizes DSE from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DSE Antibody, FITC conjugated

1-CSB-PA890925LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSE. Recognizes DSE from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DSE Antibody, Biotin conjugated

1-CSB-PA890925LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSE. Recognizes DSE from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse DSE shRNA Plasmid

20-abx980772
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ELISA kit for Human NAD (P)H-hydrate epimerase

EK2637 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NAD (P)H-hydrate epimerase in samples from serum, plasma, tissue homogenates and other biological fluids.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

DSE sgRNA CRISPR Lentivector set (Human)

K0634101 3 x 1.0 ug
EUR 339

Melatonin Sulfate (6-Hydroxymelatonin Sulfate) (6-SM) ELISA Kit

abx259368-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Estrone Sulfate (E1S) ELISA Kit

DLR-E1S-Ge-48T 48T
EUR 469
  • Should the Estrone Sulfate (E1S) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Estrone Sulfate (E1S) in samples from serum, plasma or other biological fluids.

Estrone Sulfate (E1S) ELISA Kit

DLR-E1S-Ge-96T 96T
EUR 608
  • Should the Estrone Sulfate (E1S) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Estrone Sulfate (E1S) in samples from serum, plasma or other biological fluids.

Rat Dehydroepiandrosterone sulfate ELISA kit

E02D0233-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dehydroepiandrosterone sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dehydroepiandrosterone sulfate ELISA kit

E02D0233-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dehydroepiandrosterone sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dehydroepiandrosterone sulfate ELISA kit

E02D0233-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dehydroepiandrosterone sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Indoxyl Sulfate ELISA kit

E02I0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Indoxyl Sulfate ELISA kit

E02I0039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Indoxyl Sulfate ELISA kit

E02I0039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat keratan sulfate ELISA kit

E02K0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat keratan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat keratan sulfate ELISA kit

E02K0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat keratan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat keratan sulfate ELISA kit

E02K0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat keratan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Indoxyl Sulfate ELISA kit

E04I0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Indoxyl Sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DSE(Dermatan Sulfate Epimerase) ELISA Kit

Scroll to Top