Human DSE(Dermatan Sulfate Epimerase) ELISA Kit

Human DSE(Dermatan Sulfate Epimerase) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

RD-DSE-Hu-48Tests 48 Tests
EUR 563

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

RD-DSE-Hu-96Tests 96 Tests
EUR 783

Dermatan Sulfate Epimerase (DSE) Antibody

20-abx176146
  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermatan Sulfate Epimerase (DSE) Antibody

abx122408-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dermatan Sulfate Epimerase (DSE) Antibody

20-abx172088
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermatan Sulfate Epimerase (DSE) Antibody

20-abx312163
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermatan Sulfate Epimerase (DSE) Antibody

abx232542-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Dermatan Sulfate Epimerase (DSE) Antibody

abx232543-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

20-abx151350
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx252352-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human DSE(Dermatan Sulfate Epimerase) ELISA Kit

EH2963 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9UL01
  • Alias: DSE/Dermatan Sulfate Epimerase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Dermatan- sulfate epimerase, DSE ELISA KIT

ELI-26126h 96 Tests
EUR 824

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

SEL449Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermatan Sulfate Epimerase (DSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermatan Sulfate Epimerase (DSE) in Tissue homogenates and other biological fluids.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

SEL449Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermatan Sulfate Epimerase (DSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermatan Sulfate Epimerase (DSE) in Tissue homogenates and other biological fluids.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

SEL449Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermatan Sulfate Epimerase (DSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermatan Sulfate Epimerase (DSE) in Tissue homogenates and other biological fluids.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

SEL449Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermatan Sulfate Epimerase (DSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermatan Sulfate Epimerase (DSE) in Tissue homogenates and other biological fluids.

Human Dermatan Sulfate Epimerase (DSE) ELISA Kit

4-SEL449Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dermatan Sulfate Epimerase elisa. Alternative names of the recognized antigen: DSEPI
  • SART2
  • Squamous Cell Carcinoma Antigen Recognized By T Cells 2
  • Chondroitin-glucuronate 5-epimerase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dermatan Sulfate Epimerase (DSE) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Dermatan Sulfate Epimerase (DSE) Protein

20-abx653160
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Bovine Dermatan- sulfate epimerase, DSE ELISA KIT

ELI-09256b 96 Tests
EUR 928

Mouse Dermatan- sulfate epimerase, Dse ELISA KIT

ELI-31600m 96 Tests
EUR 865

Monkey Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx359377-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx361139-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx362852-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx355938-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Dermatan Sulfate Epimerase (DSE) ELISA Kit

abx389047-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Dermatan Sulfate Epimerase (DSE) CLIA Kit

abx195547-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Dermatan Sulfate Epimerase (DSE) CLIA Kit

20-abx495929
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Dermatan Sulfate Epimerase (DSE) Antibody (HRP)

20-abx312164
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermatan Sulfate Epimerase (DSE) Antibody (FITC)

20-abx312165
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermatan Sulfate Epimerase (DSE) Antibody (Biotin)

20-abx312166
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Human DSE (Dermatan Sulfate Epimerase)

E-EL-H0369 1 plate of 96 wells
EUR 534
  • Gentaur's DSE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DSE. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DSE (Dermatan Sulfate Epimerase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human DSE (Dermatan Sulfate Epimerase)

ELK6520 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermatan Sulfate Epimerase (DSE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to D
  • Show more
Description: A sandwich ELISA kit for detection of Dermatan Sulfate Epimerase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Dermatan-sulfate epimerase (DSE)

KTE61976-48T 48T
EUR 332
  • DSE is a tumor-rejection antigen.Two transcript variants encoding the same protein have been found for this gene.Sequence analysis predicted that the 958-amino acid SART2 protein contains a signal peptide, 5 potential N-glycosylation sites, and 2 C-t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dermatan-sulfate epimerase (DSE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dermatan-sulfate epimerase (DSE)

KTE61976-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DSE is a tumor-rejection antigen.Two transcript variants encoding the same protein have been found for this gene.Sequence analysis predicted that the 958-amino acid SART2 protein contains a signal peptide, 5 potential N-glycosylation sites, and 2 C-t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dermatan-sulfate epimerase (DSE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dermatan-sulfate epimerase (DSE)

KTE61976-96T 96T
EUR 539
  • DSE is a tumor-rejection antigen.Two transcript variants encoding the same protein have been found for this gene.Sequence analysis predicted that the 958-amino acid SART2 protein contains a signal peptide, 5 potential N-glycosylation sites, and 2 C-t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dermatan-sulfate epimerase (DSE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLIA kit for Human DSE (Dermatan Sulfate Epimerase)

E-CL-H0300 1 plate of 96 wells
EUR 584
  • Gentaur's DSE CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human DSE . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human DSE (Dermatan Sulfate Epimerase) in samples from Serum, Plasma, Cell supernatant

Dse ELISA Kit| Mouse Dermatan-sulfate epimerase ELISA Kit

EF014676 96 Tests
EUR 689

DSE ELISA Kit| Bovine Dermatan-sulfate epimerase ELISA Kit

EF011307 96 Tests
EUR 689

Human Dermatan- sulfate epimerase- like protein, DSEL ELISA KIT

ELI-08823h 96 Tests
EUR 824

Mouse Dermatan- sulfate epimerase- like protein, Dsel ELISA KIT

ELI-48164m 96 Tests
EUR 865

Human dermatan sulfate ELISA Kit

ELA-E0649h 96 Tests
EUR 824

Human Dermatan sulfate ELISA kit

E01D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dermatan sulfate ELISA kit

E01D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dermatan sulfate ELISA kit

E01D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human dermatan sulfate,DS ELISA Kit

201-12-1880 96 tests
EUR 440
  • This dermatan sulfate ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Dermatan Sulfate (DS) ELISA Kit

abx252351-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human dermatan sulfate,DS ELISA Kit

CN-04521H1 96T
EUR 449

Human dermatan sulfate,DS ELISA Kit

CN-04521H2 48T
EUR 299

Human dermatan sulfate(DS)ELISA Kit

GA-E1896HM-48T 48T
EUR 289

Human dermatan sulfate(DS)ELISA Kit

GA-E1896HM-96T 96T
EUR 466

Human dermatan sulfate(DS)ELISA Kit

QY-E02241 96T
EUR 400

Rat Dermatan sulfate ELISA kit

E02D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dermatan sulfate ELISA kit

E02D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dermatan sulfate ELISA kit

E02D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dermatan sulfate ELISA kit

E03D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dermatan sulfate ELISA kit

E03D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dermatan sulfate ELISA kit

E03D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dermatan sulfate ELISA kit

E04D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dermatan sulfate ELISA kit

E04D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dermatan sulfate ELISA kit

E04D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dermatan sulfate ELISA kit

E06D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dermatan sulfate ELISA kit

E06D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dermatan sulfate ELISA kit

E06D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dermatan sulfate ELISA kit

E07D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dermatan sulfate ELISA kit

E07D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dermatan sulfate ELISA kit

E07D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dermatan sulfate ELISA kit

E08D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dermatan sulfate ELISA kit

E08D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dermatan sulfate ELISA kit

E08D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dermatan sulfate ELISA kit

E09D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dermatan sulfate ELISA kit

E09D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dermatan sulfate ELISA kit

E09D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human DS (Dermatan Sulfate)

E-EL-H1725 1 plate of 96 wells
EUR 534
  • Gentaur's DS ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DS. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DS (Dermatan Sulfate) in samples from Serum, Plasma, Cell supernatant

Pig Dermatan Sulfate (DS) ELISA Kit

abx360975-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Dermatan Sulfate (DS) ELISA Kit

abx363022-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Dermatan Sulfate (DS) ELISA Kit

abx356060-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Dermatan Sulfate (DS) ELISA Kit

abx359190-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Dermatan Sulfate (DS) ELISA Kit

abx364126-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Mouse dermatan sulfate(DS)ELISA Kit

GA-E0970MS-48T 48T
EUR 336

Mouse dermatan sulfate(DS)ELISA Kit

GA-E0970MS-96T 96T
EUR 534

Guinea pig Dermatan sulfate ELISA kit

E05D0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dermatan sulfate ELISA kit

E05D0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dermatan sulfate ELISA kit

E05D0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dermatan sulfate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dermatan Sulfate (DS) CLIA Kit

abx196603-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CLIA kit for Human DS (Dermatan Sulfate)

E-CL-H1083 1 plate of 96 wells
EUR 584
  • Gentaur's DS CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human DS . Standards or samples are added to the micro CLIA plate wells and combined with the spec
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human DS (Dermatan Sulfate) in samples from Serum, Plasma, Cell supernatant

DSE ELISA KIT|Human

EF006766 96 Tests
EUR 689

DSE ELISA Kit (Human) (OKCD02047)

OKCD02047 96 Wells
EUR 909
Description: Description of target: Converts D-glucuronic acid to L-iduronic acid (IdoUA) residues.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.114 ng/mL

DSE Antibody

1-CSB-PA890925LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSE. Recognizes DSE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DSE Antibody

DF12961 200ul
EUR 304
Description: DSE Antibody detects endogenous levels of DSE.

DSE siRNA

20-abx914656
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DSE siRNA

20-abx914657
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human DSE shRNA Plasmid

20-abx959282
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DSE cloning plasmid

CSB-CL890925HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2877
  • Sequence: atgaggactcacacacggggggctcccagtgtgtttttcatatatttgctttgctttgtgtcagcctacatcaccgacgagaacccagaagttatgattcccttcaccaatgccaactacgacagccatcccatgctgtacttctccagggcagaagtggcggagctgcagctca
  • Show more
Description: A cloning plasmid for the DSE gene.

DSE Blocking Peptide

DF12961-BP 1mg
EUR 195

DSE Polyclonal Antibody

A58858 100 µg
EUR 570.55
Description: The best epigenetics products

Human DSE(Dermatan Sulfate Epimerase) ELISA Kit

Scroll to Top