Mouse PTMS(Parathymosin) ELISA Kit

Mouse PTMS(Parathymosin) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Mouse Parathymosin (PTMS) ELISA Kit
RDR-PTMS-Mu-48Tests 48 Tests
EUR 557

Mouse Parathymosin (PTMS) ELISA Kit
RDR-PTMS-Mu-96Tests 96 Tests
EUR 774

Human Parathymosin (PTMS) ELISA Kit
DLR-PTMS-Hu-48T 48T
EUR 517
  • Should the Human Parathymosin (PTMS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Parathymosin (PTMS) in samples from serum, plasma or other biological fluids.

Human Parathymosin (PTMS) ELISA Kit
DLR-PTMS-Hu-96T 96T
EUR 673
  • Should the Human Parathymosin (PTMS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Parathymosin (PTMS) in samples from serum, plasma or other biological fluids.

Rat Parathymosin (PTMS) ELISA Kit
DLR-PTMS-Ra-48T 48T
EUR 549
  • Should the Rat Parathymosin (PTMS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Parathymosin (PTMS) in samples from serum, plasma or other biological fluids.

Rat Parathymosin (PTMS) ELISA Kit
DLR-PTMS-Ra-96T 96T
EUR 718
  • Should the Rat Parathymosin (PTMS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Parathymosin (PTMS) in samples from serum, plasma or other biological fluids.

Human Parathymosin (PTMS) ELISA Kit
RD-PTMS-Hu-48Tests 48 Tests
EUR 521

Human Parathymosin (PTMS) ELISA Kit
RD-PTMS-Hu-96Tests 96 Tests
EUR 723

Rat Parathymosin (PTMS) ELISA Kit
RD-PTMS-Ra-48Tests 48 Tests
EUR 557

Rat Parathymosin (PTMS) ELISA Kit
RD-PTMS-Ra-96Tests 96 Tests
EUR 775

Human Parathymosin (PTMS) ELISA Kit
RDR-PTMS-Hu-48Tests 48 Tests
EUR 544

Human Parathymosin (PTMS) ELISA Kit
RDR-PTMS-Hu-96Tests 96 Tests
EUR 756

Rat Parathymosin (PTMS) ELISA Kit
RDR-PTMS-Ra-48Tests 48 Tests
EUR 583

Rat Parathymosin (PTMS) ELISA Kit
RDR-PTMS-Ra-96Tests 96 Tests
EUR 811

Mouse Parathymosin (PTMS) ELISA Kit
CED220Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Parathymosin (PTMS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Parathymosin (PTMS) in serum, plasma and other biological fluids.

Mouse Parathymosin (PTMS) ELISA Kit
CED220Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Parathymosin (PTMS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Parathymosin (PTMS) in serum, plasma and other biological fluids.

Mouse Parathymosin (PTMS) ELISA Kit
CED220Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Parathymosin (PTMS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Parathymosin (PTMS) in serum, plasma and other biological fluids.

Mouse Parathymosin (PTMS) ELISA Kit
CED220Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Parathymosin (PTMS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Parathymosin (PTMS) in serum, plasma and other biological fluids.

Mouse Parathymosin (PTMS) ELISA Kit
4-CED220Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Parathymosin elisa. Alternative names of the recognized antigen: ParaT
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Mouse Parathymosin (PTMS) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Parathymosin, Ptms ELISA KIT
ELI-15073m 96 Tests
EUR 865

Mouse Parathymosin (PTMS) ELISA Kit
20-abx154506
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Parathymosin (PTMS) Protein
20-abx654655
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Parathymosin (PTMS) Protein
20-abx654656
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Mouse PTMS (Parathymosin)
ELK6450 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Parathymosin (PTMS) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Parathymosin (PTMS) and unlabeled Parathymosin (PTMS) (Standards or samples) with the pr
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Parathymosin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Parathymosin (PTMS)
KTE70619-48T 48T
EUR 332
  • Parathymosin is a polypeptide similar in size and amino acid composition to prothymosin-alpha. It has a high content of dicarboxylic amino acids and a complete absence of aromatic and sulfur-containing amino acids. It has 101 amino acid residues as c
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Parathymosin (PTMS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Parathymosin (PTMS)
KTE70619-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Parathymosin is a polypeptide similar in size and amino acid composition to prothymosin-alpha. It has a high content of dicarboxylic amino acids and a complete absence of aromatic and sulfur-containing amino acids. It has 101 amino acid residues as c
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Parathymosin (PTMS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Parathymosin (PTMS)
KTE70619-96T 96T
EUR 539
  • Parathymosin is a polypeptide similar in size and amino acid composition to prothymosin-alpha. It has a high content of dicarboxylic amino acids and a complete absence of aromatic and sulfur-containing amino acids. It has 101 amino acid residues as c
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Parathymosin (PTMS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Parathymosin (PTMS) CLIA Kit
20-abx490497
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Parathymosin (PTMS) Antibody
abx034304-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Parathymosin (PTMS) Antibody
abx034304-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Parathymosin (PTMS) Antibody
abx027033-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Parathymosin (PTMS) Antibody
abx027033-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Parathymosin (PTMS) Antibody
20-abx177914
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Parathymosin (PTMS) Antibody
20-abx177915
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Parathymosin (PTMS) Antibody
abx236925-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Parathymosin (PTMS) Protein
20-abx263385
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Bovine Parathymosin, PTMS ELISA KIT
ELI-22162b 96 Tests
EUR 928

Human Parathymosin, PTMS ELISA KIT
ELI-52418h 96 Tests
EUR 824

Rat Parathymosin, Ptms ELISA KIT
ELI-39105r 96 Tests
EUR 886

Human Parathymosin (PTMS) ELISA Kit
abx382557-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PTMS ELISA KIT|Human
EF002163 96 Tests
EUR 689

Parathymosin Antibody
20-abx114332
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Parathymosin Antibody
abx037623-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

parathymosin Antibody
39326-100ul 100ul
EUR 390

Mouse PTMS shRNA Plasmid
20-abx976886
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PTMS Recombinant Protein (Mouse)
RP165581 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

PTMS siRNA
20-abx904362
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTMS siRNA
20-abx930333
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTMS siRNA
20-abx930334
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTMS antibody
70R-19634 50 ul
EUR 435
Description: Rabbit polyclonal PTMS antibody

PTMS Antibody
1-CSB-PA019008GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PTMS. Recognizes PTMS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-PTMS
YF-PA14193 100 ug
EUR 403
Description: Rabbit polyclonal to PTMS

Ptms ORF Vector (Mouse) (pORF)
ORF055195 1.0 ug DNA
EUR 506

PTMS cloning plasmid
CSB-CL019008HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 309
  • Sequence: atgcccaggagagagagtcctcaggaaaaggccccagaggacctgaaggagaagaaggagaaggtggaggagaaggcaagccggaaagagcgaaagaaagaagtggtggaggctccagtcccattggtggtgatggtgggcaaggcatgcagccagcctgaggctactccctctcc
  • Show more
Description: A cloning plasmid for the PTMS gene.

PTMS cloning plasmid
CSB-CL019008HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 354
  • Sequence: atgaagcggatcccaaacggcagaagacagaaaatggggcatcggcgtgagcccctgccaacaggctggggttgggaggcctctctgggcctggaggtgggggtgggggcagccaagtccagccactcttcacctggctccctgctctgggccctgcaccagagctgccaccctct
  • Show more
Description: A cloning plasmid for the PTMS gene.

anti- PTMS antibody
FNab06925 100µg
EUR 585
  • Immunogen: parathymosin
  • Uniprot ID: P20962
  • Gene ID: 5763
  • Research Area: Metabolism
Description: Antibody raised against PTMS

Anti-PTMS antibody
PAab06925 100 ug
EUR 412

pCMV-SPORT6-PTMS
PVT12859 2 ug
EUR 391

Anti-PTMS (3H5)
YF-MA20404 100 ug
EUR 363
Description: Mouse monoclonal to PTMS

Anti-PTMS (2D3)
YF-MA10754 100 ug
EUR 363
Description: Mouse monoclonal to PTMS

Ptms sgRNA CRISPR Lentivector set (Mouse)
K4842301 3 x 1.0 ug
EUR 339

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Rat PTMS shRNA Plasmid
20-abx986861
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PTMS shRNA Plasmid
20-abx953894
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PTMS protein (His tag)
80R-3519 20 ug
EUR 327
Description: Purified recombinant PTMS protein (His tag)

PTMS Recombinant Protein (Human)
RP025150 100 ug Ask for price

PTMS Recombinant Protein (Human)
RP025153 100 ug Ask for price

PTMS Recombinant Protein (Rat)
RP222878 100 ug Ask for price

PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266

Ptms sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4842302 1.0 ug DNA
EUR 154

Ptms sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4842303 1.0 ug DNA
EUR 154

Ptms sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4842304 1.0 ug DNA
EUR 154

PTMS Protein Vector (Mouse) (pPB-C-His)
PV220778 500 ng
EUR 603

PTMS Protein Vector (Mouse) (pPB-N-His)
PV220779 500 ng
EUR 603

PTMS Protein Vector (Mouse) (pPM-C-HA)
PV220780 500 ng
EUR 603

PTMS Protein Vector (Mouse) (pPM-C-His)
PV220781 500 ng
EUR 603

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

PTMS ORF Vector (Human) (pORF)
ORF008384 1.0 ug DNA
EUR 95

PTMS ORF Vector (Human) (pORF)
ORF008385 1.0 ug DNA
EUR 95

Mouse PTMS(Parathymosin) ELISA Kit

Scroll to Top