Mouse TREH(Trehalase) ELISA Kit

Mouse TREH(Trehalase) ELISA Kit

To Order Contact us: mario@youngresearch.eu

Mouse Trehalase (TREH) ELISA Kit
RDR-TREH-Mu-48Tests 48 Tests
EUR 557
Mouse Trehalase (TREH) ELISA Kit
RDR-TREH-Mu-96Tests 96 Tests
EUR 774
Mouse Trehalase (TREH) ELISA Kit
RD-TREH-Mu-48Tests 48 Tests
EUR 533
Mouse Trehalase (TREH) ELISA Kit
RD-TREH-Mu-96Tests 96 Tests
EUR 740
Human Trehalase (TREH) ELISA Kit
DLR-TREH-Hu-48T 48T
EUR 517
  • Should the Human Trehalase (TREH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Trehalase (TREH) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Trehalase (TREH) ELISA Kit
DLR-TREH-Hu-96T 96T
EUR 673
  • Should the Human Trehalase (TREH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Trehalase (TREH) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Trehalase (TREH) ELISA Kit
RDR-TREH-Hu-48Tests 48 Tests
EUR 544
Human Trehalase (TREH) ELISA Kit
RDR-TREH-Hu-96Tests 96 Tests
EUR 756
Human Trehalase (TREH) ELISA Kit
RD-TREH-Hu-48Tests 48 Tests
EUR 521
Human Trehalase (TREH) ELISA Kit
RD-TREH-Hu-96Tests 96 Tests
EUR 723
Mouse Trehalase (TREH) ELISA Kit
20-abx154804
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Trehalase, Treh ELISA KIT
ELI-16880m 96 Tests
EUR 865
Mouse Trehalase (TREH) ELISA Kit
SEG871Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Trehalase (TREH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Trehalase (TREH) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Trehalase (TREH) ELISA Kit
SEG871Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Trehalase (TREH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Trehalase (TREH) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Trehalase (TREH) ELISA Kit
SEG871Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Trehalase (TREH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Trehalase (TREH) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Trehalase (TREH) ELISA Kit
SEG871Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Trehalase (TREH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Trehalase (TREH) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Trehalase (TREH) ELISA Kit
4-SEG871Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Trehalase elisa. Alternative names of the recognized antigen: TRE
  • TREA
  • Brush Border Membrane Glycoprotein
  • Alpha, Alpha-Trehalase
  • Alpha, Alpha-Trehalose Glucohydrolase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Trehalase (TREH) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mouse Trehalase (TREH) Protein
20-abx168356
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Trehalase (TREH) CLIA Kit
20-abx495314
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Trehalase (TREH) Antibody
20-abx178711
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Trehalase (TREH) Antibody
20-abx128642
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Trehalase (TREH) Antibody
20-abx129790
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Trehalase (TREH) Antibody
abx145339-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Recombinant Trehalase (TREH)
4-RPG871Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O43280
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.9kDa
  • Isoelectric Point: 6.1
Description: Recombinant Human Trehalase expressed in: E.coli
Recombinant Trehalase (TREH)
4-RPG871Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9JLT2
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.4kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Trehalase expressed in: E.coli
ELISA kit for Mouse TREH (Trehalase)
ELK6623 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Trehalase (TREH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Trehalase (TREH).
  • Show more
Description: A sandwich ELISA kit for detection of Trehalase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse Trehalase (TREH)
KTE70059-48T 48T
EUR 332
  • Trehalose (1-alpha-D-glucopyranosyl alpha-D-glucopyranoside) is widely distributed in nature, being the storage disaccharide of fungi and the blood sugar of insects. Trehalase (EC 3.2.1.28) is an intrinsic glycoprotein of the small intestine and rena
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Trehalase (TREH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Trehalase (TREH)
KTE70059-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Trehalose (1-alpha-D-glucopyranosyl alpha-D-glucopyranoside) is widely distributed in nature, being the storage disaccharide of fungi and the blood sugar of insects. Trehalase (EC 3.2.1.28) is an intrinsic glycoprotein of the small intestine and rena
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Trehalase (TREH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Trehalase (TREH)
KTE70059-96T 96T
EUR 539
  • Trehalose (1-alpha-D-glucopyranosyl alpha-D-glucopyranoside) is widely distributed in nature, being the storage disaccharide of fungi and the blood sugar of insects. Trehalase (EC 3.2.1.28) is an intrinsic glycoprotein of the small intestine and rena
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Trehalase (TREH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Trehalase, TREH ELISA KIT
ELI-36552h 96 Tests
EUR 824
Rabbit Trehalase, TREH ELISA KIT
ELI-40079Ra 96 Tests
EUR 928
Human Trehalase(TREH)ELISA Kit
QY-E03233 96T
EUR 361
Human Trehalase (TREH) Protein
20-abx166569
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Trehalase (TREH) Polyclonal Antibody (Human, Mouse)
4-PAG871Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (His237~Pro420)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH)
Trehalase (TREH) Polyclonal Antibody (Mouse, Rat)
4-PAG871Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (Ser151~Tyr411)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH)
Trehalase (TREH) Polyclonal Antibody (Human, Mouse), APC
4-PAG871Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (His237~Pro420)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with APC.
Trehalase (TREH) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAG871Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (His237~Pro420)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with Biotin.
Trehalase (TREH) Polyclonal Antibody (Human, Mouse), Cy3
4-PAG871Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (His237~Pro420)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with Cy3.
Trehalase (TREH) Polyclonal Antibody (Human, Mouse), FITC
4-PAG871Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (His237~Pro420)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with FITC.
Trehalase (TREH) Polyclonal Antibody (Human, Mouse), HRP
4-PAG871Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (His237~Pro420)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with HRP.
Trehalase (TREH) Polyclonal Antibody (Human, Mouse), PE
4-PAG871Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (His237~Pro420)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with PE.
Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), APC
4-PAG871Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (Ser151~Tyr411)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with APC.
Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAG871Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (Ser151~Tyr411)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with Biotin.
Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAG871Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (Ser151~Tyr411)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with Cy3.
Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), FITC
4-PAG871Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (Ser151~Tyr411)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with FITC.
Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), HRP
4-PAG871Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (Ser151~Tyr411)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with HRP.
Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), PE
4-PAG871Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (Ser151~Tyr411)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with PE.
Trehalase (TREH) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAG871Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (His237~Pro420)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with APC-Cy7.
Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAG871Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TREH (Ser151~Tyr411)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with APC-Cy7.
TREH ELISA Kit (Mouse) (OKCD01166)
OKCD01166 96 Wells
EUR 857
Description: Description of target: Intestinal trehalase is probably involved in the hydrolysis of ingested trehalose. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.216 ng/mL
Trehalase Assay Kit
abx096014-100Assays 100 Assays
EUR 551
  • Shipped within 5-10 working days.
Mouse TREH shRNA Plasmid
20-abx975117
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TREH Recombinant Protein (Mouse)
RP180962 100 ug Ask for price
Trehalase antibody
23114-100ul 100ul
EUR 390
Trehalase antibody
70R-13329 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal Trehalase antibody
TREH Antibody
1-CSB-PA024402LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TREH. Recognizes TREH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
TREH siRNA
20-abx937974
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TREH siRNA
20-abx937975
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Treh ORF Vector (Mouse) (pORF)
ORF060322 1.0 ug DNA
EUR 506
Neutral trehalase Antibody
20-abx110630
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse Acid trehalase- like protein 1, Athl1 ELISA KIT
ELI-11412m 96 Tests
EUR 865
Mouse Acid Trehalase-Like Protein 1 (ATHL1) ELISA Kit
abx388626-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Acid trehalase like protein 1(ATHL1) ELISA kit
E03A1753-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Acid trehalase like protein 1(ATHL1) ELISA kit
E03A1753-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Acid trehalase like protein 1(ATHL1) ELISA kit
E03A1753-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
TREH Polyclonal Antibody
28947-100ul 100ul
EUR 252
TREH Polyclonal Antibody
28947-50ul 50ul
EUR 187
TREH Rabbit pAb
A15397-100ul 100 ul
EUR 308
TREH Rabbit pAb
A15397-200ul 200 ul
EUR 459
TREH Rabbit pAb
A15397-20ul 20 ul
EUR 183
TREH Rabbit pAb
A15397-50ul 50 ul
EUR 223
TREH cloning plasmid
CSB-CL024402HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1659
  • Sequence: ATGCCAGGGAGGACCTGGGAGCTGTGCCTGCTACTGCTGCTGGGGCTGGGACTGGGGTCCCAGGAGGCCCTACCCCCACCCTGTGAGAGTGAGATTTACTGCCACGGGGAGCTCCTAAACCAAGTTCAAATGGCCAAGCTCTACCAGGATGACAAGCAGTTTGTGGACATGCCAC
  • Show more
Description: A cloning plasmid for the TREH gene.
Anti-TREH antibody
STJ117592 100 µl
EUR 277
Description: This gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. A partial duplication of this gene is located adjacent to this locus on chromosome 11. Two transcript variants encoding different isoforms have been found for this gene.
Athl1 ELISA Kit| Mouse Acid trehalase-like protein 1 ELISA Kit
EF014251 96 Tests
EUR 689
Treh sgRNA CRISPR Lentivector set (Mouse)
K3815801 3 x 1.0 ug
EUR 339
Neutral trehalase Antibody (Biotin)
20-abx106363
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neutral trehalase Antibody (FITC)
20-abx107776
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neutral trehalase Antibody (HRP)
20-abx109193
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TREH Polyclonal Conjugated Antibody
C28947 100ul
EUR 397
TREH Antibody, HRP conjugated
1-CSB-PA024402LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TREH. Recognizes TREH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TREH Antibody, FITC conjugated
1-CSB-PA024402LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TREH. Recognizes TREH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TREH Antibody, Biotin conjugated
1-CSB-PA024402LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TREH. Recognizes TREH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human TREH shRNA Plasmid
20-abx957661
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TREH Recombinant Protein (Rat)
RP234584 100 ug Ask for price
TREH Recombinant Protein (Human)
RP044434 100 ug Ask for price
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Treh sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3815802 1.0 ug DNA
EUR 154
Treh sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3815803 1.0 ug DNA
EUR 154
Treh sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3815804 1.0 ug DNA
EUR 154
TREH Protein Vector (Mouse) (pPB-C-His)
PV241286 500 ng
EUR 603
TREH Protein Vector (Mouse) (pPB-N-His)
PV241287 500 ng
EUR 603
TREH Protein Vector (Mouse) (pPM-C-HA)
PV241288 500 ng
EUR 603
TREH Protein Vector (Mouse) (pPM-C-His)
PV241289 500 ng
EUR 603
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Human Acid trehalase- like protein 1, ATHL1 ELISA KIT
ELI-11363h 96 Tests
EUR 824
Human Acid Trehalase-Like Protein 1 (ATHL1) ELISA Kit
abx384605-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse TREH(Trehalase) ELISA Kit

Scroll to Top